Transcript asmbl_106096

Sequence
Transcript Sequence for observation asmbl_106096 of TGE0058503:
CGGTTCCCTCCCTGCTGCTTACTCGGCGCCCGCGCCTCGGGCCGTCGGGAGCGGAGCCTCCTCGGGACCAGGACTTCAGGGCCACAGGTGCTGCCAAGATGCTCCAGGGCACCTGCTCCGTGCTCCTGCTCTGGGGAATCCTGGGGGCCATCCAGGCCCAGCAGCAGGAGGTCATCTCGCCGGACACTACCGAGAGAAACAACAACTGCCCAGAGAAGACCGACTGCCCCATCCACGTGTACTTCGTGCTGGACACCTCGGAGAGCGTCACCATGCAGTCCCCCACGGACATCCTGCTCTTCCACATGAAGCAGTTCGTGCCGCAGTTCATCAGCCAGCTGCAGAACGAGTTCTACCTGGACCAGGTGGCGCTGAGCTGGCGCTACGGCGGCCTGCACTTCTCTGACCAGGTGGAGGTGTTCAGCCCACCGGGCAGCGACCGGGCCTCCTTCATCAAGAACCTGCAGGGCATCAGCTCCTTCCGCCGCGGCACCTTCACCGACTGCGCGCTGGCCAACATGACGGAGCAGATCCGGCAGGACCGCAGCAAGGGCACCGTCCACTTCGCCGTGGTCATCACCGACGGCCACGTCACCGGCAGCCCCTGCGGGGGCATCAAGCTGCAGGCCGAGCGGGCCCGCGAGGAGGGCATCCGGCTCTTCGCCGTGGCCCCCAACCAGAACCTGAAGGAGCAGGGCCTGCGGGACATCGCCAGCACGCCGCACGAGCTCTACCGCAACGACTACGCCACCATGCTGCCCGACTCCACCGAGATCGACCAGGACACCATCAACCGCATCATCAAGGTCATGAAACACGAAGCCTACGGAGAGTGCTACAAGGTGAGCTGCCTGGAAATCCCTGGGCCCTCTGGCCCCAAGGGCTACCGTGGACAGAAGGGTGCCAAGGGCAACATGGGTGAGCCGGGAGAGCCTGGCCAGAAGGGAAGACAGGGAGACCCGGGCATCGAAGGCCCCATTGGATTCCCAGGACCCAAGGGCGTTCCTGGCTTCAAAGGAGAGAAGGGTGAATTTGGAGCCGACGGTCGCAAGGGGGCCCCTGGCCTGGCTGGCAAGAACGGGACCGATGGACAGAAGGGCAAGCTGGGGCGCATCGGACCTCCTGGCTGCAAGGGAGACCCTGGAAACCGGGGCCCCGACGGTTACCCGGGGGAAGCAGGGAGTCCAGGGGAGCGAGGAGACCAAGGCGGCAAGGGGGACCCTGGCCGCCCAGGACGCAGAGGGCCCCCGGGAGAAATCGGGGCCAAGGGAAGCAAGGGGTATCAAGGCAACAGTGGAGCCCCAGGAAGTCCTGGTGTGAAAGGAGCCAAGGGCGGGCCTGGGCCCCGCGGACCCAAAGGCGAGCCGGGGCGCAGGGGAGACCCCGGCACCAAGGGCAGCCCAGGCAGCGATGGCCCCAAGGGGGAGAAGGGGGACCCTGGCCCTGAGGGGCCCCGCGGCCTGGCTGGAGAGGTTGGCAACAAAGGAGCCAAGGGAGACCGAGGCTTGCCTGGACCCAGAGGCCCCCAGGGAGCTCTTGGGGAGCCCGGAAAGCAGGGATCTCGGGGAGACCCCGGTGATGCAGGACCCCGTGGAGACTCAGGACAGCCAGGCCCCAAGGGAGACCCCGGCAGGCCTGGATTCAGCTACCCAGGACCCCGAGGAGCACCCGGAGAAAAAGGCGAGCCCGGCCCACGCGGCCCCGAGGGAGGCCGAGGCGACTTTGGCTTGAAAGGAGAACCTGGGAGGAAAGGAGAGAAAGGAGAGCCTGCGGATCCTGGTCCCCCTGGTGAGCCAGGCCCTCGGGGGCCAAGAGGAGTCCCAGGACCCGAGGGTGAGCCCGGCCCCCCTGGAGACCCCGGTCTCACGGAGTGTGACGTCATGACCTACGTGAGGGAGACCTGCGGGTGCTGCGACTGTGAGAAGCGCTGTGGCGCCCTGGACGTGGTCTTCGTCATCGACAGCTCCGAGAGCATTGGGTACACCAACTTCACACTGGAGAAGAACTTCGTCATCAACGTGGTCAACAGGCTGGGTGCCATCGCTAAGGACCCCAAGTCCGAGACAGGGACGCGTGTGGGCGTGGTGCAGTACAGCCACGAGGGCACCTTTGAGGCCATCCAGCTGGACGACGAACGTATCGACTCCCTGTCGAGCTTCAAGGAGGCTGTCAAGAACCTCGAGTGGATTGCGGGCGGCACCTGGACACCCTCAGCCCTCAAGTTTGCCTACGACCGCCTCATCAAGGAGAGCCGGCGCCAGAAGACACGTGTGTTTGCGGTGGTCATCACGGACGGGCGCCACGACCCTCGGGACGATGACCTCAACTTGCGGGCGCTGTGCGACCGCGACGTCACAGTGACGGCCATCGGCATCGGGGACATGTTCCACGAGAAGCACGAGAGTGAAAACCTCTACTCCATCGCCTGCGACAAGCCACAGCAGGTGCGCAACATGACGCTGTTCTCCGACCTGGTCGCTGAGAAGTTCATCGATGACATGGAGGACGTCCTCTGCCCGGACCCTCAGATCGTGTGCCCAGACCTTCCCTGCCAAACAGAGCTGTCCGTGGCACAGTGCACGCAGCGGCCCGTGGACATCGTCTTCCTGCTGGACGGCTCCGAGCGGCTGGGTGAGCAGAACTTCCACAAGGCCCGGCGCTTCGTGGAGCAGGTGGCGCGGCGGCTGACGCTGGCCCGGAGGGACGACGACCCTCTCAACGCACGCGTGGCGCTGCTGCAGTTTGGTGGCCCCGGCGAGCAGCAGGTGGCCTTCCCGCTGAGCCACAACCTCACGGCCATCCACGAGGCGCTGGAGACCACACAATACCTGAACTCCTTCTCGCACGTGGGCGCAGGCGTGGTGCACGCCATCAATGCCATCGTGCGCAGCCCGCGTGGCGGGGCCCGGAGGCACGCAGAGCTGTCCTTCGTGTTCCTCACGGACGGCGTCACGGGCAACGACAGTCTGCACGAGTCGGCGCACTCCATGCGCAAGCAGAACGTGGTACCCACCGTGCTGGCCTTGGGCAGCGACGTGGACATGGACGTGCTCACCACGCTCAGCCTGGGTGACCGCGCCGCCGTGTTCCACGAGAAGGACTATGACAGCCTGGCGCAACCCGGCTTCTTCGACCGCTTCATCCGCTGGATCTGCTAGCGCCGCCGCCCGGGCCCCGCAGTCGAGGGTCGTGAGCCCACCCCGTCCATGGTGCTAAGCGGGCCCGGGTCCCACACGGCCAGCACCGCTGCTCACTCGGACGACGCCCTGGGCCTGCACCTCTCCAGCTCCTCCCACGGGGTCCCCGTAGCCCCGGCCCCCGCCCAGCCCCAGGTCTCCCCAGGCCCTCCGCAGGCTGCCCGGCCTCCCTCCCCCTGCAGCCATCCCAAGGCTCCTGACCTACCTGGCCCCTGAGCTCTGGAGCAAGCCCTGACCCAATAAAGGCTTTGAACCCAT