Transcript asmbl_105429

Sequence
Transcript Sequence for observation asmbl_105429 of TGE0001511:
GCACATTCTTCTGCCTTGTAAGGCCCGGCCGCCACGCCCCGCCCCCGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGAAGCCCCACCCACCAGAAGCCAAGATGTCCAGCAAGCGGGCCAAAGCCAAGACCACCAAGAAGCGGCCACAGCGGGCCACATCCAATGTCTTCGCAATGTTTGACCAGTCCCAGATCCAGGAGTTTAAGGAGGCTTTCAACATGATTGACCAGAACCGTGATGGCTTCATTGACAAGGAGGACCTGCACGACATGCTGGCCTCGCTGGGGAAGAACCCCACAGACGAATACCTGGAGGGCATGATGAGCGAGGCCCCGGGGCCCATCAACTTCACCATGTTCCTCACCATGTTTGGGGAGAAGCTGAACGGCACGGACCCCGAGGATGTGATTCGCAACGCCTTTGCCTGCTTCGACGAGGAAGCCTCAGGTTTCATCCATGAGGACCACCTCCGGGAGCTGCTCACCACCATGGGTGACCGCTTCACAGATGAGGAAGTGGACGAGATGTACCGGGAGGCACCCATTGATAAGAAAGGCAACTTCAACTACGTGGAGTTCACCCGCATCCTCAAACATGGCGCCAAGGATAAAGACGACTAGGCCACCCCAGCCCCCTGACACCCCAGCCCCCGCCAGTCACCCCTCCCCGCACACACCCGTCCATACCAGCTCCCTGCCCATGACCCTCGCTCAGGGATCCCCCTTTGAGGGGTTAGGGTCCCAGTTCCCAGTGGAAGAAACAGGCCAGGAGAAGTGCGTGCCGAGCTGAGGCAGATGTTCCCACAGTGACCCCAGAGCCCTGGGCTATAGTCTCTGACCCCTCCAAGGAAAGACCACCTTCTGGGGACATGGGCTGGAGGGCAGGACCTAGAGGCACCAAGGGAAGGCCCCATTCCGGGGCTGTTCCCCGAGGAGGAAGGGAAGGGGCTCTGTGTGCCCCCCAGGAGGAAGAGGCCCTGAGTCCTGGGATCAGACACCCCTTCACGTGTATCCCCACACAAATGCAAGCTCACCAAGGTCCCCTCTCAGTCCCCTTCCCTACACCCTGACCGGCCACTGCCGCACACCCACCCAGAGCACGCCACCCGCCATGGGAGTGTGCTCAGGAGTCGCGGGCAGCGTGGACATCTGTCCCAGAGGGGGCAGAATCTCCAATAGAGGACTGAGCACTGCTTCTGGTCTGTGTGTCTGTGGCTGGGGTGAAGTAAGGGGACCCCGGGCCTGAAACCCTCTCCCACCTTCTCCTGCCATCTCCAGTTACTGCCCTGCTCCTCCCACCCTGGCCCAGGG