Transcript asmbl_105048

Sequence
Transcript Sequence for observation asmbl_105048 of TGE0058500:
GGAATGGGCTGGCCCTGAGGTGGGGCAGGGACCTCCCCAGACTCAACGGCCATTGCACTCCCAGCACCACACCACCGGCGTCAACTGTGAGCGCTGCCTGCCCGGCTTCTACCGCTCTCCCAACCACCCTCTCGACTCGCCCCACGTCTGCCGCCGCTGCAACTGCGAGTCCGACTTCACGGATGGCACCTGCGAGGACCTGACGGGTCGATGCTACTGCCGGCCCAACTTCTCTGGGGAGCGGTGTGACGTGTGTGCCGAGGGCTTCACGGGCTTCCCAAGCTGCTACCCGACGCCCTCGTCCTCCAATGACACCAGGGAGCAGGTGCTGCCAGCCGGCCAGATTGTGAATTGTGACTGCAGCGCGGCAGGGACCCAGGGCAACGCCTGCCGGAAGGACCCAAGGGTGGGACGCTGTCTGTGCAAACCCAACTTCCAAGGCACCCATTGTGAGCTCTGCGCGCCAGGGTTCTACGGCCCCGGCTGCCAGCCCTGCCAGTGTTCCAGCCCTGGAGTGGCCGATGACCGCTGTGACCCTGACACAGGCCAGTGCAGGTGCCGAGTGGGCTTCGAGGGGGCCACATGTGATCGCTGTGCCCCCGGCTACTTTCACTTCCCTCTCTGCCAGTTGTGTGGCTGCAGCCCTGCAGGAACCTTGCCCGAGGGCTGCGATGAGGCCGGCCGCTGCCTATGCCAGCCTGAGTTTGCTGGACCTCATTGTGACCGGTGCCGCCCTGGCTACCATGGTTTCCCCAACTGCCAAGCATGCACCTGCGACCCTCGGGGAGCCCTGGACCAGCTCTGTGGGGCGGGAGGTTTGTGCCGCTGCCGCCCCGGCTACACAGGCACTGCCTGCCAGGAATGCAGCCCCGGCTTTCACGGCTTCCCCAGCTGTGTCCCCTGCCACTGCTCTGCTGAAGGCTCCCTGCACGCAGCCTGTGACCCCCGGAGTGGGCAGTGCAGCTGCCGGCCCCGTGTGACGGGGCTGCGGTGTGACACATGTGTGCCCGGTGCCTACAACTTCCCCTACTGCGAAGCTGGCTCTTGCCACCCTGCCGGTCTGGCCCCAGTGGATCCTGCCCTTCCTGAGGCACAGGTTCCCTGTATGTGCCGGGCTCACGTGGAGGGGCCGAGCTGTGACCGCTGCAAACCTGGGTTCTGGGGACTGAGCCCCAGCAACCCCGAGGGCTGTACCCGCTGCAGCTGCGACCTCAGGGGCACACTGGGTGGAGTTGCTGAGTGCCAGCCGGGCACCGGCCAGTGCTTCTGCAAGCCCCACGTGTGCGGCCAGGCCTGCGCGTCCTGCAAGGATGGCTTCTTTGGACTGGATCAGGCTGACTATTTTGGCTGCCGCAGCTGCCGGTGTGACATTGGCGGTGCACTGGGCCAGAGCTGTGAACCGAGGACGGGCGTCTGCCGGTGCCGCCCCAACACCCAGGGCCCCACCTGCAGCGAGCCTGCGAGGGACCACTACCTCCCGGACCTGCACCACCTGCGCCTGGAGCTGGAGGAGGCTGCCACACCTGAGGGTCACGCCGTGCGCTTTGGCTTCAACCCCCTCGAGTTCGAGAACTTCAGCTGGAGGGGCTACGCGCAGATGGCACCTGTCCAGCCCAGGATCGTGGCCAGGCTGAACCTGACCTCCCCTGACCTTTTCTGGCTCGTCTTCCGATACGTCAACCGGGGGGCCATGAGTGTGAGCGGGCGGGTCTCTGTGCGAGAGGAGGGCAGGTCGGCCACCTGCGCCAACTGCACAGCACAGAGTCAGCCCGTGGCCTTCCCACCCAGCACGGAGCCTGCCTTCATCACCGTGCCCCAGAGGGGCTTCGGAGAGCCCTTTGTGCTGAACCCTGGCACCTGGGCCCTGCGTGTGGAGGCCGAAGGGGTGCTCCTGGACTACGTGGTTCTGCTGCCTAGCGCATACTACGAGGCGGCGCTCCTGCAGCTGCGGGTGACTGAGGCCTGCACATACCGTCCCTCTGCCCAGCAGTCTGGCGACAACTGCCTCCTCTACACACACCTCCCCCTGGATGGCTTCCCCTCGGCCGCCGGGCTGGAGGCCCTGTGTCGCCAGGACAACAGCCTGCCCCGGCCCTGCCCCACGGAGCAGCTCAGCCCGTCGCACCCGCCACTGATCACCTGCACGGGCAGTGATGTGGACGTCCAGCTTCAAGTGGCAGTGCCACAGCCAGGCCGCTATGCCCTAGTGGTGGAGTACGCCAATGAGGATGCCCGCCAGGAGGTGGGCGTGGCCGTGCACACCCCACAGCGGGCCCCCCAGCAGGGGCTGCTCTCCCTGCACCCCTGCCTGTACAGCACCCTGTGCCGGGGCACTGCCCGGGATACCCAGGACCACCTGGCTGTCTTCCACCTGGACTCGGAGGCCAGCGTGAGGCTCACAGCCGAACAGGCACGCTTCTTCCTGCACGGGGTCACTCTGGTGCCCATTGAGGAGTTCAGCCCGGAGTTCGTGGAGCCCCGGGTCAGCTGCATCAGCAGCCACGGCGCCTTTGGCCCCAACAGTGCCGCCTGTCTGCCCTCGCGCTTCCCAAAGCCGCCCCAGCCCATCATCCTCAGGGACTGCCAGGTGATCCCGCTGCCGCCCGGCCTCCCGCTGACCCACGCGCAGGATCTCACTCCAGCCATGTCCCCAGCTGGACCCCGACCTCGGCCCCCCACCGCTGTGGACCCTGATGCAGAGCCCACCCTGCTGCGTGAGCCCCAGGCCACCGTGGTCTTCACCACCCATGTGCCCACGCTGGGCCGCTATGCCTTCCTGCTGCACGGCTACCAGCCAGCCCACCCCACCTTCCCCGTGGAAGTCCTCATCAACGCCGGCCGCGTGTGGCAGGGCCACGCCAACGCCAGCTTCTGTCCACATGGCTACGGCTGCCGCACCCTGGTGGTGTGTGAGGGCCAGGCCCTGCTGGACGTGACCCACAGCGAGCTCACTGTGACCGTGCGTGTGCCCAAGGGCCGGTGGCTCTGGCTGGATTATGTACTCGTGGTCCCTGAGAACGTCTACAGCTTTGGCTACCTCCGGGAGGAGCCCCTGGATAAATCCTATGACTTCATCAGCCACTGCGCAGCCCAGGGCTACCACATCAGCCCCAGCAGCTCATCCCTGTTCTGCCGAAACGCTGCTGCTTCCCTCTCCCTCTTCTATAACAACGGAGCCCGTCCATGTGGCTGCCACGAAGTAGGTGCTACAGGCCCCACGTGTGAGCCCTTCGGGGGCCAGTGTCCCTGCCATGCCCATGTCATTGGCCGTGACTGCTCCCGCTGTGCCACCGGATACTGGGGCTTCCCCAACTGCAGGCCCTGTGACTGCGGTGCCCGCCTCTGTGACGAGCTCACGGGCCAGTGCATCTGCCCGCCACGCACCATCCCGCCCGACTGCCTGCTGTGCCAGCCCCAGACCTTTGGCTGCCACCCCCTGGTCGGCTGTGAGGAGTGTAACTGCTCAGGGCCCGGCATCCAGGAGCTCACAGACCCTACCTGTGACACAGACAGCGGCCAGTGCAAGTGCAGACCCAACGTGACTGGGCGCCGCTGTGATACCTGCTCTCCGGGCTTCCATGGCTACCCCCGCTGCCGCCCCTGTGACTGTCACGAGGCGGGCACTGCGCCTGGCGTGTGTGACCCCCTCACAGGGCAGTGCTACTGTAAGGAGAACGTGCAGGGCCCCAAATGTGACCAGTGCAGCCTTGGGACCTTCTCACTGGATGCTGCCAACCCCAAAGGTTGCACCCGCTGCTTCTGCTTTGGGGCCACGGAGCGCTGCCGGAGCTCGTCCTACACCCGCCAGGAGTTCGTGGATATGGAGGGATGGGTGCTGCTGAGCACTGACCGGCAGGTGGTGCCCCACGAGCGGCAGCCAGGGACGGAGATGCTCCGTGCAGACCTGCGGCACGTGCCTGAGGCTGTGCCCGAGGCTTTCCCCGAGCTGTACTGGCAGGCCCCACCCTCCTACCTGGGGGACCGGGTGTCATCCTACGGTGGGACCCTCCGTTATGAACTGCACTCAGAGACCCAGCGGGGAGATGTCTTTGTCCCCATGGAGAGCAGGCCGGATGTGGTGCTGCAGGGCAACCAGATGAGCATCACATTCCTGGAGCCGGCATACCCCACGCCTGGCCACGTTCACCGTGGGCAGCTGCAGCTGGTGGAGGGGAACTTCCGGCATACGGAGACGCGCAACACTGTGTCCCGCGAGGAGCTCATGATGGTGCTGGCCAGCCTGGAGCAGCTGCAGATCCGTGCCCTCTTCTCACAGATCTCCTCGGCTGTCTTCCTGCGCAGGGTGGCACTGGAGGTGGCCAGCCCAGCAGGCCAGGGGGCCCTGGCCAGCAATGTGGAGCTGTGCCTGTGCCCCGCCAGCTACCGGGGGGACTCATGCCAGGAATGTGCCCCCGGCTTCTATCGGGACGTCAAAGGTCTCTTCCTGGGCCGATGTGTCCCTTGTCAGTGCCATGGACACTCAGACCGCTGCCTCCCTGGCTCTGGCGTCTGTGTGGACTGCCAGCACAACACCGAAGGGGCCCACTGTGAGCGCTGCCAGGCTGGCTTCGTGAGCAGCAGGGACGACCCCAGCGCCCCCTGTGTCAGCTGCCCCTGCCCCCTCTCAGTGCCTTCCAACAACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGCACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTGTGCGCCCGGATTCTTTGGGAACCCACTGGTGCTGGGCAGCTCCTGCCAGCCATGCGACTGCAGCGGCAACGGTGACCCCAACTTGCTCTTCAGCGACTGCGACCCCCTGACGGGCGCCTGCCGTGGCTGCCTGCGCCACACCACTGGGCCCCGCTGCGAGATCTGTGCCCCCGGCTTCTACGGCAACGCCCTGCTGCCCGGCAACTGCACCCGGTGCGACTGTACCCCATGTGGGACAGAGGCCTGCGACCCCCACAGCGGGCACTGCCTGTGCAAGGCGGGCGTGACTGGGCGGCGCTGTGACCGCTGCCAGGAGGGACATTTTGGTTTCGATGGCTGCGGGGGCTGCCGCCCGTGTGCTTGTGGACCGGCCGCCGAGGGCTCCGAGTGCCACCCCCAGAGCGGACAGTGCCACTGCCGACCAGGGACCATGGGACCCCAGTGCCGCGAGTGTGCCCCTGGCTACTGGGGGCTCCCTGAGCAGGGCTGCAGGCGCTGCCAGTGCCCTGGGGGCCGCTGTGACCCTCACACGGGCCGCTGCAACTGCCCCCCGGGGCTCAGCGGGGAGCGCTGCGACACCTGCAGCCAGCAGCATCAGGTGCCTGTTCCAGGCGGGCCTGTGGGCCACAGCATCCACTGTGAAGTGTGTGACCACTGTGTGGTCCTGCTCCTGGATGACCTGGAACGGGCCGGCGCCCTCCTCCCCGCCATTCACGAGCAACTGCGTGGCATCAATGCCAGCTCCATGGCCTGGGCCCGTCTGCACAGGCTGAACGCCTCCATCGCTGACCTGCAGAGCCAGCTCCGGAGCCCCCTGGGCCCCCGCCATGAGACGGCACAGCAGCTGGAGGTGCTGGAGCAGCAGAGCACAAGCCTCGGGCAGGACGCACGGCGGCTAGGCGGCCAGGCCGTGGGGACCCGAGACCAGGCGAGCCAATTGCTGGCCGGCACCGAGGCCACACTGGGCCATGCGAAGACGCTGTTGGCGGCCATCCGGGCTGTGGACCGCACCCTGAGCGAGCTCATGTCCCAGACGGGCCACCTGGGGCTGGCCAATGCCTCGGCTCCATCAGGTGAGCAGCTGCTCCGGACACTGGCCGAGGTGGAGCGGCTGCTCTGGGAGATGCGGGCCCGGGACCTGGGGGCCCCGCAGGCAGCAGCTGAGGCTGAGTTGGCTGCAGCACAGAGATTGCTGGCCCGGGTGCAGGAGCAGCTGAGCAGCCTCTGGGAGGAGAACCAGGCACTGGCCACACAAACCCGCGACCGGCTGGCCCAGCACGAGGCCGGCCTCATGGACCTGCGAGAGGCTTTGAACCGGGCAGTGGACGCCACACGGGAGGCCCAGGAGCTCAACAGCCGCAACCAGGAGCGCCTGGAGGAAGCCCTGCAAAGGAAGCAGGAGCTGTCCCGGGACAATGCCACCCTGCAGGCCACTCTGCATGCGGCTAGGGACACCCTGGCCAGCGTCTTCAGATTGCTGCACAGCCTGGACCAGGCTAAGGAGGAGCTGGAGCGCCTCGCCGCCAGCCTGGATGGGGCTCGGACCCCACTGCTGCAGAGGATGCAGACCTTCTCCCCGGCGGGCAGCAAGCTGCGTCTAGTGGAGGCCGCCGAGGCCCACGCACAGCAGCTGGGCCAGCTGGCACTCAATCTGTCCAGCATCATCCTGGACGTCAACCAGGACCGCCTCACCCAGAGGGCCATCGAGGCCTCCAACGCCTACAGCCGCATCCTGCAGGCCGTGCAGGCTGCCGAGGATGCTGCTGGCCAGGCCCTGCAGCAGGCGGACCACACGTGGGCGACGGTGGTGCGGCAGGGCCTGGTGGACCGAGCCCAGCAGCTCCTGGCCAACAGCACTGCACTAGAAGAGGCCATGCTCCAGGAACAGCAGAGGCTGGGCCTTGGTGAGTGCTGGGCTCCGATGGGGGCCCTTAGGCCTGCTGGGCATCTGAGCTCCCAGGGACCCTCAGCCCCCAGCCACATGCACACGTGGGGTTTGTGGGTCACCGCAGCATGGTTTGGGGTGGGAGAGCTTTGGAGATGGCTCCCCAGCTGCTTGTGTGTCAGCCCCGGGGAGCCCTGCAGGGGAGTCCAGGGAGGAGCAGCCTCCTGCGAGGCACTGGCTGCCACTGAGGCACCA