Transcript asmbl_105043

Sequence
Transcript Sequence for observation asmbl_105043 of TGE0058495:
CGCCTGGCTTCAGACCCGCCGGGCTCCCGCCGCGCGCGCTGTCCCTGGAGCTCGGGGACGCGGCCCGGAGCCGGGAAGATGGCGAAGCGGCTCTGCGCGGGGAGCGCACTGTGTGTTCGCGGCCCCCGGGGCCCCGCGCCGCTGCTGCTGGTCGGGCTGGCGCTGCTGGGCGCGGCGCGGGCGCGGGAGGAGGCGGGCGGCGGCTTCAGCCTGCACCCGCCCTACTTCAACCTGGCCGAGGGCGCCCGCATCGCCGCCTCCGCGACCTGCGGAGAGGAGGCCCCGGCGCGCGGCTCCCCGCGCCCCACCGAGGACCTTTACTGCAAGCTGGTAGGGGGCCCCGTGGCCGGCGGCGACCCCAACCAGACCATCCGGGGCCAGTACTGTGACATCTGCACGGCTGCCAACAGCAACAAGGCACACCCCGCGAGCAATGCCATCGATGGCACGGAGCGCTGGTGGCAGAGTCCACCGCTGTCCCGCGGCCTGGAGTACAACGAGGTCAACGTCACCCTGGACCTGGGCCAGGTCTTCCACGTGGCCTACGTCCTCATCAAGTTTGCCAACTCACCCCGGCCGGACCTCTGGGTGCTGGAGCGGTCCATGGACTTCGGCCGCACCTACCAGCCCTGGCAGTTCTTTGCCTCCTCCAAGAGGGACTGTCTGGAGCGGTTCGGGCCACAGACGCTGGAGCGCATCACACGGGACGACGCGGCCATCTGCACCACCGAGTACTCACGCATCGTGCCCCTGGAGAACGGAGAGATCGTGGTGTCCCTGGTGAACGGACGTCCGGGCGCCATGAATTTCTCCTACTCGCCGCTGCTACGTGAGTTCACCAAGGCCACCAACGTCCGCCTGCGCTTCCTGCGTACCAACACGCTGCTGGGCCATCTCATGGGGAAGGCGCTGCGGGACCCCACGGTCACCCGCCGGTATTATTACAGCATCAAGGATATCAGCATCGGAGGCCGCTGTGTCTGCCACGGCCACGCGGATGCCTGCGATGCCAAAGACCCCACGGACCCGTTCAGGCTGCAGTGCACCTGCCAGCACAACACCTGCGGGGGCACCTGCGACCGCTGCTGCCCCGGCTTCAATCAGCAGCCGTGGAAGCCTGCGACTGCCAACAGTGCCAACGAGTGCCAGTCCTGTAACTGCTACGGCCATGCCACCGACTGTTACTACGACCCTGAGGTGGACCGGCGCCGCGCCAGCCAGAGCCTGGATGGCACCTATCAGGGTGGGGGTGTCTGTATCGACTGCCAGCACCACACCACCGGCGTCAACTGTGAGCGCTGCCTGCCCGGCTTCTACCGCTCTCCCAACCACCCTCTCGACTCGCCCCACGTCTGCCGCCGCTGCAACTGCGAGTCCGACTTCACGGATGGCACCTGCGAGGACCTGACGGGTCGATGCTACTGCCGGCCCAACTTCTCTGGGGAGCGGTGTGACGTGTGTGCCGAGGGCTTCACGGGCTTCCCAAGCTGCTACCCGACGCCCTCGTCCTCCAATGACACCAGGGAGCAGGTGCTGCCAGCCGGCCAGATTGTGAATTGTGACTGCAGCGCGGCAGGGACCCAGGGCAACGCCTGCCGGAAGGACCCAAGGGTGGGACGCTGTCTGTGCAAACCCAACTTCCAAGGCACCCATTGTGAGCTCTGCGCGCCAGGGTTCTACGGCCCCGGCTGCCAGCCCTGCCAGTGTTCCAGCCCTGGAGTGGCCGATGACCGCTGTGACCCTGACACAGGCCAGTGCAGGTGCCGAGTGGGCTTCGAGGGGGCCACATGTGATCGCTGTGCCCCCGGCTACTTTCACTTCCCTCTCTGCCAGTTGTGTGGCTGCAGCCCTGCAGGAACCTTGCCCGAGGGCTGCGATGAGGCCGGCCGCTGCCTATGCCAGCCTGAGTTTGCTGGACCTCATTGTGACCGGTGCCGCCCTGGCTACCATGGTTTCCCCAACTGCCAAGCATGCACCTGCGACCCTCGGGGAGCCCTGGACCAGCTCTGTGGGGCGGGAGGTTTGTGCCGCTGCCGCCCCGGCTACACAGGCACTGCCTGCCAGGAATGCAGCCCCGGCTTTCACGGCTTCCCCAGCTGTGTCCCCTGCCACTGCTCTGCTGAAGGCTCCCTGCACGCAGCCTGTGACCCCCGGAGTGGGCAGTGCAGCTGCCGGCCCCGTGTGACGGGGCTGCGGTGTGACACATGTGTGCCCGGTGCCTACAACTTCCCCTACTGCGAAGCTGGCTCTTGCCACCCTGCCGGTCTGGCCCCAGTGGATCCTGCCCTTCCTGAGGCACAGGTTCCCTGTATGTGCCGGGCTCACGTGGAGGGGCCGAGCTGTGACCGCTGCAAACCTGGGTTCTGGGGACTGAGCCCCAGCAACCCCGAGGGCTGTACCCGCTGCAGCTGCGACCTCAGGGGCACACTGGGTGGAGTTGCTGAGTGCCAGCCGGGCACCGGCCAGTGCTTCTGCAAGCCCCACGTGTGCGGCCAGGCCTGCGCGTCCTGCAAGGATGGCTTCTTTGGACTGGATCAGGCTGACTATTTTGGCTGCCGCAGCTGCCGGTGTGACATTGGCGGTGCACTGGGCCAGAGCTGTGAACCGAGGACGGGCGTCTGCCGGTGCCGCCCCAACACCCAGGGCCCCACCTGCAGCGAGCCTGCGAGGGACCACTACCTCCCGGACCTGCACCACCTGCGCCTGGAGCTGGAGGAGGCTGCCACACCTGAGGGTCACGCCGTGCGCTTTGGCTTCAACCCCCTCGAGTTCGAGAACTTCAGCTGGAGGGGCTACGCGCAGATGGCACCTGTCCAGCCCAGGATCGTGGCCAGGCTGAACCTGACCTCCCCTGACCTTTTCTGGCTCGTCTTCCGATACGTCAACCGGGGGGCCATGAGTGTGAGCGGGCGGGTCTCTGTGCGAGAGGAGGGCAGGTCGGCCACCTGCGCCAACTGCACAGCACAGAGTCAGCCCGTGGCCTTCCCACCCAGCACGGAGCCTGCCTTCATCACCGTGCCCCAGAGGGGCTTCGGAGAGCCCTTTGTGCTGAACCCTGGCACCTGGGCCCTGCGTGTGGAGGCCGAAGGGGTGCTCCTGGACTACGTGGTTCTGCTGCCTAGCGCATACTACGAGGCGGCGCTCCTGCAGCTGCGGGTGACTGAGGCCTGCACATACCGTCCCTCTGCCCAGCAGTCTGGCGACAACTGCCTCCTCTACACACACCTCCCCCTGGATGGCTTCCCCTCGGCCGCCGGGCTGGAGGCCCTGTGTCGCCAGGACAACAGCCTGCCCCGGCCCTGCCCCACGGAGCAGCTCAGCCCGTCGCACCCGCCACTGATCACCTGCACGGGCAGTGATGTGGACGTCCAGCTTCAAGTGGCAGTGCCACAGCCAGGCCGCTATGCCCTAGTGGTGGAGTACGCCAATGAGGATGCCCGCCAGGAGGTGGGCGTGGCCGTGCACACCCCACAGCGGGCCCCCCAGCAGGGGCTGCTCTCCCTGCACCCCTGCCTGTACAGCACCCTGTGCCGGGGCACTGCCCGGGATACCCAGGACCACCTGGCTGTCTTCCACCTGGACTCGGAGGCCAGCGTGAGGCTCACAGCCGAACAGGCACGCTTCTTCCTGCACGGGGTCACTCTGGTGCCCATTGAGGAGTTCAGCCCGGAGTTCGTGGAGCCCCGGGTCAGCTGCATCAGCAGCCACGGCGCCTTTGGCCCCAACAGTGCCGCCTGTCTGCCCTCGCGCTTCCCAAAGCCGCCCCAGCCCATCATCCTCAGGGACTGCCAGGTGATCCCGCTGCCGCCCGGCCTCCCGCTGACCCACGCGCAGGATCTCACTCCAGCCATGTCCCCAGCTGGACCCCGACCTCGGCCCCCCACCGCTGTGGACCCTGATGCAGAGCCCACCCTGCTGCGTGAGCCCCAGGCCACCGTGGTCTTCACCACCCATGTGCCCACGCTGGGCCGCTATGCCTTCCTGCTGCACGGCTACCAGCCAGCCCACCCCACCTTCCCCGTGGAAGTCCTCATCAACGCCGGCCGCGTGTGGCAGGGCCACGCCAACGCCAGCTTCTGTCCACATGGCTACGGCTGCCGCACCCTGGTGGTGTGTGAGGGCCAGGCCCTGCTGGACGTGACCCACAGCGAGCTCACTGTGACCGTGCGTGTGCCCAAGGGCCGGTGGCTCTGGCTGGATTATGTACTCGTGGTCCCTGAGAACGTCTACAGCTTTGGCTACCTCCGGGAGGAGCCCCTGGATAAATCCTATGACTTCATCAGCCACTGCGCAGCCCAGGGCTACCACATCAGCCCCAGCAGCTCATCCCTGTTCTGCCGAAACGCTGCTGCTTCCCTCTCCCTCTTCTATAACAACGGAGCCCGTCCATGTGGCTGCCACGAAGTAGGTGCTACAGGCCCCACGTGTGAGCCCTTCGGGGGCCAGTGTCCCTGCCATGCCCATGTCATTGGCCGTGACTGCTCCCGCTGTGCCACCGGATACTGGGGCTTCCCCAACTGCAGGCCCTGTGACTGCGGTGCCCGCCTCTGTGACGAGCTCACGGGCCAGTGCATCTGCCCGCCACGCACCATCCCGCCCGACTGCCTGCTGTGCCAGCCCCAGACCTTTGGCTGCCACCCCCTGGTCGGCTGTGAGGAGTGTAACTGCTCAGGGCCCGGCATCCAGGAGCTCACAGACCCTACCTGTGACACAGACAGCGGCCAGTGCAAGTGCAGACCCAACGTGACTGGGCGCCGCTGTGATACCTGCTCTCCGGGCTTCCATGGCTACCCCCGCTGCCGCCCCTGTGACTGTCACGAGGCGGGCACTGCGCCTGGCGTGTGTGACCCCCTCACAGGGCAGTGCTACTGTAAGGAGAACGTGCAGGGCCCCAAATGTGACCAGTGCAGCCTTGGGACCTTCTCACTGGATGCTGCCAACCCCAAAGGTTGCACCCGCTGCTTCTGCTTTGGGGCCACGGAGCGCTGCCGGAGCTCGTCCTACACCCGCCAGGAGTTCGTGGATATGGAGGGATGGGTGCTGCTGAGCACTGACCGGCAGGTGGTGCCCCACGAGCGGCAGCCAGGGACGGAGATGCTCCGTGCAGACCTGCGGCACGTGCCTGAGGCTGTGCCCGAGGCTTTCCCCGAGCTGTACTGGCAGGCCCCACCCTCCTACCTGGGGGACCGGGTGTCATCCTACGGTGGGACCCTCCGTTATGAACTGCACTCAGAGACCCAGCGGGGAGATGTCTTTGTCCCCATGGAGAGCAGGCCGGATGTGGTGCTGCAGGGCAACCAGATGAGCATCACATTCCTGGAGCCGGCATACCCCACGCCTGGCCACGTTCACCGTGGGCAGCTGCAGCTGGTGGAGGGGAACTTCCGGCATACGGAGACGCGCAACACTGTGTCCCGCGAGGAGCTCATGATGGTGCTGGCCAGCCTGGAGCAGCTGCAGATCCGTGCCCTCTTCTCACAGATCTCCTCGGCTGTCTTCCTGCGCAGGGTGGCACTGGAGGTGGCCAGCCCAGCAGGCCAGGGGGCCCTGGCCAGCAATGTGGAGCTGTGCCTGTGCCCCGCCAGCTACCGGGGGGACTCATGCCAGGTGAGGTTAGGACAGCACCAGACTGCGAGGCGGCTCACCTGTGCACACCCTTCCCTCCAGCATCCTCCCTGTGTTCCCTTCCTTGCTGCCTCCACTTCCTGTCACCCTACTCACCTCTCTTCCTGCCCCTGCTTTTCACAGGCTGCTGGCCAACTCATGGGCCTGCCTGTCCCCTGCTGCCTGTCTGCCTGCCCCTCGTCCGCCTGCCTGCCCCTCATCCGCCTGCCCCTCCATGCACACACCCTCCATACCCCTTTCCCACCTACCCCAGCCCCCACCACTGGGTCACCTGGACATCCCCCACCGACCATCCTGGCGTCTGCCTGTCATTCTGCCCATCCCTCGCCCACTGTGTGTCTGTCCAGCTGCTAATCTGCCCTGCTAATCTGTCTGTCTGCTGTAACTTTGCTCCTTCTGTATGAGGAGGTTTGTGGTTGAATACCTCCTAGAAGGAGTGGAAAGAGTAGGCCCTGGTCCACATGGAGTGGGTGGTCACCAGCCCCAAGGCCTGGTCATTCCCGAGACAGGACATCCGTGTGGCTTTGAGAGCTATGTCCTCAAACAGCAGCCAGGTGCTGGCCCACCTCCAGCCGGCCGAGGCCAGGAGTTCCTGACCAGCCTCTGACCCAGCGGTGACCATGCTCCACGGGTTCCCAGTGCCTCGTGCCTGCAGGATCCCTGAGGGTCTGACTTGTGAGCTTGCAGGGTGGGGCCCCTCGTCCTCTCAATCGCTGATGCCACCTGCCCCCGTACACCCTCAGGAATGTGCCCCCGGCTTCTATCGGGACGTCAAAGGTCTCTTCCTGGGCCGATGTGTCCCTTGTCAGTGCCATGGACACTCAGACCGCTGCCTCCCTGGCTCTGGCGTCTGTGTGGACTGCCAGCACAACACCGAAGGGGCCCACTGTGAGCGCTGCCAGGCTGGCTTCGTGAGCAGCAGGGACGACCCCAGCGCCCCCTGTGTCAGCTGCCCCTGCCCCCTCTCAGTGCCTTCCAACAACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGCACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTGTGCGCCCGGATTCTTTGGGAACCCACTGGTGCTGGGCAGCTCCTGCCAGCCATGCGACTGCAGCGGCAACGGTGACCCCAACTTGCTCTTCAGCGACTGCGACCCCCTGACGGGCGCCTGCCGTGGCTGCCTGCGCCACACCACTGGGCCCCGCTGCGAGATCTGTGCCCCCGGCTTCTACGGCAACGCCCTGCTGCCCGGCAACTGCACCCGGTGCGACTGTACCCCATGTGGGACAGAGGCCTGCGACCCCCACAGCGGGCACTGCCTGTGCAAGGCGGGCGTGACTGGGCGGCGCTGTGACCGCTGCCAGGAGGGACATTTTGGTTTCGATGGCTGCGGGGGCTGCCGCCCGTGTGCTTGTGGACCGGCCGCCGAGGGCTCCGAGTGCCACCCCCAGAGCGGACAGTGCCACTGCCGACCAGGGACCATGGGACCCCAGTGCCGCGAGTGTGCCCCTGGCTACTGGGGGCTCCCTGAGCAGGGCTGCAGGCGCTGCCAGTGCCCTGGGGGCCGCTGTGACCCTCACACGGGCCGCTGCAACTGCCCCCCGGGGCTCAGCGGGGAGCGCTGCGACACCTGCAGCCAGCAGCATCAGGTGCCTGTTCCAGGCGGGCCTGTGGGCCACAGCATCCACTGTGAAGTGTGTGACCACTGTGTGGTCCTGCTCCTGGATGACCTGGAACGGGCCGGCGCCCTCCTCCCCGCCATTCACGAGCAACTGCGTGGCATCAATGCCAGCTCCATGGCCTGGGCCCGTCTGCACAGGCTGAACGCCTCCATCGCTGACCTGCAGAGCCAGCTCCGGAGCCCCCTGGGCCCCCGCCATGAGACGGCACAGCAGCTGGAGGTGCTGGAGCAGCAGAGCACAAGCCTCGGGCAGGACGCACGGCGGCTAGGCGGCCAGGCCGTGGGGACCCGAGACCAGGCGAGCCAATTGCTGGCCGGCACCGAGGCCACACTGGGCCATGCGAAGACGCTGTTGGCGGCCATCCGGGCTGTGGACCGCACCCTGAGCGAGCTCATGTCCCAGACGGGCCACCTGGGGCTGGCCAATGCCTCGGCTCCATCAGGTGAGCAGCTGCTCCGGACACTGGCCGAGGTGGAGCGGCTGCTCTGGGAGATGCGGGCCCGGGACCTGGGGGCCCCGCAGGCAGCAGCTGAGGCTGAGTTGGCTGCAGCACAGAGATTGCTGGCCCGGGTGCAGGAGCAGCTGAGCAGCCTCTGGGAGGAGAACCAGGCACTGGCCACACAAACCCGCGACCGGCTGGCCCAGCACGAGGCCGGCCTCATGGACCTGCGAGAGGCTTTGAACCGGGCAGTGGACGCCACACGGGAGGCCCAGGAGCTCAACAGCCGCAACCAGGAGCGCCTGGAGGAAGCCCTGCAAAGGAAGCAGGAGCTGTCCCGGGACAATGCCACCCTGCAGGCCACTCTGCATGCGGCTAGGGACACCCTGGCCAGCGTCTTCAGATTGCTGCACAGCCTGGACCAGGCTAAGGAGGAGCTGGAGCGCCTCGCCGCCAGCCTGGATGGGGCTCGGACCCCACTGCTGCAGAGGATGCAGACCTTCTCCCCGGCGGGCAGCAAGCTGCGTCTAGTGGAGGCCGCCGAGGCCCACGCACAGCAGCTGGGCCAGCTGGCACTCAATCTGTCCAGCATCATCCTGGACGTCAACCAGGACCGCCTCACCCAGAGGGCCATCGAGGCCTCCAACGCCTACAGCCGCATCCTGCAGGCCGTGCAGGCTGCCGAGGATGCTGCTGGCCAGGCCCTGCAGCAGGCGGACCACACGTGGGCGACGGTGGTGCGGCAGGGCCTGGTGGACCGAGCCCAGCAGCTCCTGGCCAACAGCACTGCACTAGAAGAGGCCATGCTCCAGGAACAGCAGAGGCTGGGCCTTGGTGAGTGCTGGGCTCCGATGGGGGCCCTTAGGCCTGCTGGGCATCTGAGCTCCCAGGGACCCTCAGCCCCCAGCCACATGCACACGTGGGGTTTGTGGGTCACCGCAGCATGGTTTGGGGTGGGAGAGCTTTGGAGATGGCTCCCCAGCTGCTTGTGTGTCAGCCCCGGGGAGCCCTGCAGGGGAGTCCAGGGAGGAGCAGCCTCCTGCGAGGCACTGGCTGCCACTGAGGCACCA