Transcript asmbl_104859

Sequence
Transcript Sequence for observation asmbl_104859 of TGE0056320:
GTCCAGGTGTCTGTTCTCCAAGGTCTGAGTCTGTGGGTCCAGGTGTGTCTGTATCCTGGGCTAGTTGTGTGTCCCTGTCCGCTCCCCCAGGGGGCGCCCTCGTCCGGCCGCCGTCCCTCCCTCGGGCTCCGGTCCCCTGGGTGAGCCCCAGCGCTGGCGGCGTGGGCCCGGGACTGGGCAATGGGTGGCCTCCCAGGTCGCCGCCTTCCCGCGGGGCCCCGCCCCCGGCCCGCCCCAAAGCGGGCTATAAGTTAGCGCCGCTCTCCGCCTCGGCAGTGCCAGCCGCCAGTGGTCGCACTTGGAGGGTCTCGCCGCCAGTGGAAGGAGCCACCGCCCCCGCCCGACCATGGCCGAGGAGCTGGTCTTAGAGAGGTGTGATCTGGAGCTGGAGACCAATGGCCGAGACCACCACACGGCCGACCTGTGCCGGGAGAAGCTGGTGGTGCGACGGGGCCAGCCCTTCTGGCTGACCCTGCACTTTGAGGGCCGCAACTACGAGGCCAGTGTAGACAGTCTCACCTTCAGTGTCGTGACCGGCCCAGCCCCTAGCCAGGAGGCCGGGACCAAGGCCCGTTTTCCACTAAGAGATGCTGTGGAGGAGGGTGACTGGACAGCCACCGTGGTGGACCAGCAAGACTGCACCCTCTCGCTGCAGCTCACCACCCCGGCCAACGCCCCCATCGGCCTGTATCGCCTCAGCCTGGAGGCCTCCACTGGCTACCAGGGATCCAGCTTTGTGCTGGGCCACTTCATTTTGCTCTTCAACGCCTGGTGCCCAGCGGATGCTGTGTACCTGGACTCGGAAGAGGAGCGGCAGGAGTATGTCCTCACCCAGCAGGGCTTTATCTACCAGGGCTCGGCCAAGTTCATCAAGAACATACCTTGGAATTTTGGGCAGTTTGAAGATGGGATCCTAGACATCTGCCTGATCCTTCTAGATGTCAACCCCAAGTTCCTGAAGAACGCCGGCCGTGACTGCTCCCGCCGCAGCAGCCCCGTCTACGTGGGCCGGGTGGTGAGTGGCATGGTCAACTGCAACGATGACCAGGGTGTGCTGCTGGGACGCTGGGACAACAACTACGGGGACGGCGTCAGCCCCATGTCCTGGATCGGCAGCGTGGACATCCTGCGGCGCTGGAAGAACCACGGCTGCCAGCGCGTCAAGTATGGCCAGTGCTGGGTCTTCGCCGCCGTGGCCTGCACAGTGCTGAGGTGCCTGGGCATCCCTACCCGCGTCGTGACCAACTACAACTCGGCCCATGACCAGAACAGCAACCTTCTCATCGAGTACTTCCGCAATGAGTTTGGGGAGATCCAGGGTGACAAGAGCGAGATGATCTGGAACTTCCACTGCTGGGTGGAGTCGTGGATGACCAGGCCGGACCTGCAGCCGGGGTACGAGGGCTGGCAGGCCCTGGACCCAACGCCCCAGGAGAAGAGCGAAGGGACGTACTGCTGTGGCCCAGTTCCAGTTCGTGCCATCAAGGAGGGCGACCTGAGCACCAAGTACGATGCGCCCTTTGTCTTTGCGGAGGTCAATGCCGACGTGGTAGACTGGATCCAGCAGGACGATGGGTCTGTGCACAAATCCATCAACCGTTCCCTGATCGTTGGGCTGAAGATCAGCACTAAGAGCGTGGGCCGAGACGAGCGGGAGGATATCACCCACACCTACAAATACCCAGAGGGGTCCTCAGAGGAGAGGGAGGCCTTCACAAGGGCGAACCACCTGAACAAACTGGCCGAGAAGGAGGAGACAGGGATGGCCATGCGGATCCGTGTGGGCCAGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGCCTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGGAGTCCAACCTCATCAAGGTGCGGGCCCTCCTCGTGGAGCCAGTTATCAACAGCTACCTGCTGGCTGAGAGGGACCTCTACCTGGAGAATCCAGAAATCAAGATCCGGATCCTTGGGGAGCCCAAGCAGAAACGCAAGCTGGTGGCTGAGGTGTCCCTGCAGAACCCGCTCCCTGTGGCCCTGGAAGGCTGCACCTTCACTGTGGAGGGGGCCGGCCTGACTGAGGAGCAGAAGACGGTGGAGATCCCAGACCCCGTGGAGGCAGGGGAGGAAGTTAAGGTGAGAATGGACCTGCTGCCGCTCCACATGGGCCTCCACAAGCTGGTGGTGAACTTCGAGAGCGACAAGCTGAAGGCTGTGAAGGGCTTCCGGAATGTCATCATTGGCCCCGCCTAAGGGACCCCTGCTCCCAGCCTGCTGAGAGCCCCCACCTTGATCCCAATCCTTATCCCAAGCTAGTGAGCAAAATATGCCCCTTCTTGGGCCCCAGACCCCAGGGCAGGGTGGGCAGCCTATGGGGGCTCTCGGAAATGGAATGTGCCCCTGGCCCATCTCAGCCTCCTGAGCCTGTGGGTCCCCACTCACCCCCTTTGCTGTGAGGAATGCTCTGTGCCAGAAACAGTGGGAGCCCTGACCTTGGCTGACTGGGGCTGGGGTGAGAGAGGAAAGACCTACATTCCCTCTCCTGCCCAGATGCCCTTTGGAAAGCCATTGACCACCCACCATATTGTTTGATCTACTTCATAGCTCCTTGGAGCAGGCAAAAAAGGGACAGCATGCCCCTTGGCTGGATCAGGGAATCCAGCTCCCTAGACTGCATCCCGTACCTCTTCCCATGACTGCACCCAGCTCCAGGGGCCCTTGGGACAGCCAGAGCTGGGTGGGGACAGTGATAGGCCCAAGGTCCCCTCCACATCCCAGCAGCCCAAGCTTAATAGCCCTCCCCCTCAACCTCACCATTGTGAAGCACCTACTATGTGCTGGGTGCCTCCCACACTTGCTGGGGCTCACGGGGCCTCCAACCCATTTAATCACCATGGGAAACTGTTGTGGGCGCTGCTTCCAGGATAAGGAGACTGAGGCTTAGAGAGAGGAGGCAGCCCCCTCCACACCAGTGGCCTCGTGGTTATTAGCAAGGCTGGGTAATGTGAAGGCCCAAGAGCAGAGTCTGGGCCTCTGACTCTGAGTCCACTGCTCCATTTATAACCCCAGCCTGACCTGAGACTGTCGGAGAGGCTGTCTGGGGCCTTTATCAAAAAAAGACTCAGCCAAGACAAGGAGGTAGAGAGGGGACTGGGGGACTGGGAGTCAGAGCCCTGGCTGGGTTCAGGTCCCACGTCTGGCCAGGCACTGCCTTCTCCTCTCTGGGCCTTTGTTTCCTTGTTGGTCAGAGGAGTGATTGAACCAGCTCATCTCCAAGGATCCTCTCCACTCCATGTTTGCAATGCTTTTATATGGCCCAGCCTTGTAAATAACCACAAGGTCCACTCCCTGCTCCACGAAGCCTTAAGCCATAGGCCCAGGATATTTCTGAGAGTGAAACCATGACTGTGACCACCTTCTGTCCCCAGCCCTGTCCTGGTTCCTTCCTATGCCCAGGTACCACCCTTCAGACCCCAGTTCTAGGGGAGAAGAGCCCTGGACACCCCTGCTCTACCCATGAGCCTGCCCGCTGCAATGCCTAGACTTCCCAACAGCCTTAGCTGCCAGTGCTGGTCACTAACCAACAAGGTTGGCACCCCAGCTACCCCTTCTTTGCAGGGCTAAGGCCCCCAAACATAGCCCCTGCCCCGGAGGAAGCTTGGGGAACCCATGAGTTGTCAGCTTTGACTTTATCTCCTGCTCTTTCTACATGACTGGGCCTCCCTTGGGCTGGAAGAATTGGGGATTCTCTATTGGAGGTGAGATCACAGCCTCCAGGGCCCCCCAAATCCCAGGGAAGGACTTGGAGAGAATCATGCTGTTGCATTTAGAACTTTCTGCTTTGCACAGGAAAGAGTCACACAATTAATCAACATGTATATTTTCTCTATACATAGAGCTCTATTTCTCTACGGTTTTATAAAAGCCTTGGGTTCCAACCAGGCAGTAGATGTGCTTCTGAACCGCAAGGAGCAAACACTGAAATAAAATAGTTTATTTTTCACACTCAAACTAGGTCTGGTCTGTTCCTTTATGAGTTTGGAGGGAGA