Transcript asmbl_104688

Sequence
Transcript Sequence for observation asmbl_104688 of TGE0057824:
GGGGGAGGGCGGGCCTGGAGTCTGAGCCGGCGCCGCTCAGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGTACCATGAGCGAGGCGGACGGGCTGCGACAGCGCCGGCCCCTGCGGCCGCAGGTCGTCACAGACGATGATGGCCAGGCCCCGGAGGCTAAGGACGGCAGCTCCTTTAGCGGCAGAGTTTTCCGAGTGACCTTCTTGATGCTGGCTGTTTCTCTCACCGTTCCCCTGCTTGGAGCCATGATGCTGCTGGAATCTCCTATAGATCCACAGCCTCTCAGCTTCAAAGAACCCCCGCTCTTGCTTGGTGTTCTGCATCCAAATACGAAGCTGCGACAGGCAGAAAGGCTGTTTGAAAATCAACTTGTTGGACCGGAGTCCATAGCACATATTGGGGATGTGATGTTTACTGGGACAGCAGATGGCCGGGTCGTAAAACTTGAAAATGGTGAAATAGAGACCATTGCCCGGTTTGGTTCGGGCCCTTGCAAAACCCGAGATGATGAGCCTGTGTGTGGGAGACCCCTGGGTATCCGTGCAGGGCCCAATGGGACTCTCTTTGTGGCCGATGCATACAAGGGACTATTTGAAGTAAATCCCTGGAAACGTGAAGTGAAACTGCTGCTGTCCTCCGAGACACCCATTGAGGGGAAGAACATGTCCTTTGTGAATGATCTTACAGTCACTCAGGATGGGAGGAAGATTTATTTCACCGATTCTAGCAGCAAATGGCAAAGACGAGACTACCTGCTTCTGGTGATGGAGGGCACAGATGACGGGCGCCTGCTGGAGTATGATACTGTGACCAGGGAAGTAAAAGTTTTATTGGACCAGCTGCGGTTCCCGAATGGAGTCCAGCTGTCTCCTGCAGAAGACTTTGTCCTGGTGGCAGAAACAACCATGGCCAGGATACGAAGAGTCTACGTTTCTGGCCTGATGAAGGGCGGGGCTGATCTGTTTGTGGAGAACATGCCTGGATTTCCAGACAACATCCGGCCCAGCAGCTCTGGGGGGTACTGGGTGGGCATGTCGACCATCCGCCCTAACCCTGGGTTTTCCATGCTGGATTTCTTATCTGAGAGACCCTGGATTAAAAGGATGATTTTTAAGGTAACTGTGAAAACTGTTATTCCAAGAAAGAAAATGGAAATGAATTGAATCATATTTTTTTGACCCTTATAGCTTAAAAATCTAGTTCTGCTTGTAGTATTTGGCTCTGAATGACACTTAGAAACACATTTCATTCTTCATCCTGAAATGCAGATTTAAACATTTGGACCCTTTGGTTCTTATGGTTTTCCTTTTTCTGGGTGTTTTTATTGTCACCCTCACCATCGTGGCTTTGGGCATCTGCCTGCCTGTCAGTCTCTGGTTCCCTGTTTCTGGGTGTTTTGATTGCCACCCTCACCATCGTGGCTCTGGGCATCTGCGTGCCTGTCAGTCTTGCTCCTCCATCTGCCATGGCTTTGCCAGGCCTTCTGTGCTCTCCACCCCCCTCTCTGCCTCCTCAGGGAAAGAGTCGGCAGGTGCCCTTTCCTCCCCTCCCTGCAGGTGTGGCCACCCCTGTAACCTAGTCACCACAGCTGCCATCCCGCCTGCTCCCTGCTGCCTTCTTGCAGCCTCACTGCCAGGCACTCTTCTCTATGGAGTTCTGCCCTTTGACCTCTTACCACACCCAAATCTTTCCCTTTTTAAAAAAAAGTCACCCACCCCCACCAATGGCCAGCCATGGCCCCTTCAACACAACAGCCCCTTCAACACAGCCTTTAAATCTTGCCATTTTCCCAGTGGCTTCCATGAAGCACCCCACATAATAACTCAGCACGTTTACACTGTGGAGGGGTCACTTGCTGATGTGGGCACTTGTGTAATACAGAGATCTGCTTTTCCAGCAAGCTCCGTGTCACAGGCTGAATAGGTATTTTAAATTGATACTGAATATTTGAACCGATATGGAAATACTAGCTTATGGTCCTGGGGCTGACAGGCAGCAGTTGCTGAGTCCTGTTGCTGGGCTGTGTGTCTGGACCCCTCCTGGGGGCTGCGTGCACATTCTCAGTTAGACTGGCTCACGGCCTTCAGTGATGTGAGTTCTGTGGGTCGCTGTGTGGGAAGTCCTAATCTGTTGAGAAATCTGTCCTTCTCTTTGCCTTATTGGCTCCAGAGACAGCATCTGTTCCTGCTGGGACCTAGGGGGAGGCAAAATGGCAGGTGGGCTAGCACAGGGGTTTTGGAGGCTGCCAGACCAGCTGTGGGATCCTGGGCCGGGGACTTGGACTCGCTGCCTCAGGTGCTCTGTCTGTAAAGTGGAAAGAATAATAGTGCCTCATCAGGTGCTGGGAACATTTAGTGAGAATCTGCACATAGTGCCCTTAGCGTAGGGTAGTATGAGTGGTGGTTGTGTCTCTTCCCCTGAATAGAATGTGCATACCATCAGAGCAGGTGTTTTTCTGTTTAGTTCATGCATAGTTCATTTGTCATCCTCCACACCTGCAACAGTGCCTGGCACATGTAGGTGCGAGGACGTACCGTTGATTGAGGGCACAGTTAGGGAGGGGGCTGCAAGCATGAGGGAACATGGAGTCTTCCTGCAGCTGGGTGAGGAGGGGTGAGAGGGAGGACCACAGCCCCATGGACTTGGAAAGAAGGTTCAGTTTTATTCAAAATGTAATCCAAGTCATTGAAGATTTTTTTGTTTTTTGTTTTTGAGAC