Transcript asmbl_95149

Sequence
Transcript Sequence for observation asmbl_95149 of TGE0058491:
CATAAATGAGCTGGTGAGGTTGAAGTGTTGGGTGGGGCAGGTGGGTGTAGATGTTCCTCTCACAGGGCCCTGACTTGTTCTGTGCCTGGCAGGTGTGTGGGGCACCAGGGGATGCACCCTGTGCTACAAGCCCTTGTGGGGGTGCCGGCTGTCGAGATGAGGATGGGCAGCCGCGCTGTGGGGGCCTCAGCTGCAATGGGGCAGCGGCTACAGCAGACCTAGCACTGGGCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGGCACTGGCAGAAGGTGGTAGCATCCTCAGCAGAGTGGCTGAGACTCGTCGGCAGGCAAGCGAGGCACAGCAGCGGGCCCAGGCAGCCCTGGACAAGGCTAATGCTTCCAGGGGACAGGTGGAACAGGCCAACCAGGAACTTCAAGAACTTATCCAGAGTGTGAAGGACTTCCTCAACCAGGAGGGGGCTGATCCTGATAGCATTGAAATGGTGGCCACACGGGTGCTAGAGCTCTCCATCCCAGCTTCAGCTGAGCAGATCCAGCACCTGGCGGGTGCGATTGCAGAGCGAGTCCGGAGCCTGGCAGATGTGGATGCGATCCTGGCACGTACTGTAGGAGATGTGCGTCGTGCCGAGCAGCTACTGCAGGATGCACGGCGGGCAAGGAGCTGGGCTGAGGATGAGAAACAGAAGGCAGAGACAGTACAGGCAGCACTGGAGGAGGCCCAGCGGGCACAGGGTATTGCCCAGGGTGCCATCCGGGGGGCAGTGGCTGACACACGGGACACAGAGCAGACCCTGTACCAGGTACAGGAGAGGATGGCAGGTGCAGAGCGGGCACTGAGCTCTGCAGGTGAAAGGGCTCGGCAGTTGGATGCTCTCCTGGAGGCTCTGAAATTGAAACGGGCAGGAAATAGTCTGGCAGCCTCTACAGCAGAAGAAACGGCAGGCAGTGCCCAGGGTCGTGCCCAGGAGGCTGAGCAGGTGGGTTGAGGCAGAGCCAGCTGGAGAAGGTAGGGGTGGAAGATGGGCCTCCACTGAGCTACCACGCTAACCTAACCCTCTACATCTGCAGCTGCTACGCGGTCCTCTGGGTGATCAGTACCAGACGGTGAAGGCCCTAGCTGAGCGCAAGGCCCAAGGTGTGCTGGCTGCACAGGCAAGGGCAGAACAACTGCGGGATGAGGCTCGGGACCTGTTGCAAGCCGCTCAGGACAAGCTGCAGCGGCTACAGGAATTGGAAGGCACCTATGAGGAAAATGAGCGGGCACTGGAGAGTAAGGCAGCCCAGTTGGACGGGTTGGAGGCCAGGATGCGCAGCGTGCTTCAAGCCATCAACTTGCAGGTGCAGATCTACAACACCTGCCAGTGACCCCTGCCCAAGGCCTACCCCAGTTCCTAGCACTGCCCCACATGCATGTCTGCCTATGCACTGAAGAGCTCTTGGCCCGGCAGGGCCCCCAATAAACCAGTGTGAACCCCC