Transcript asmbl_75893

Sequence
Transcript Sequence for observation asmbl_75893 of TGE0056297:
GGTGCGCTTCCTGGAGCAGCAGAACGCGGCGCTCGCCGCCGAAGTGAACCGGCTCAAGGGCCGCGAGCCGACGCGAGTGGCCGAGCTCTACGAGGAGGAGCTGCGGGAGCTGCGGCGCCAGGTGGAGGTGCTCACTAACCAGCGCGCGCGCGTCGACGTCGAGCGCGACAACCTGCTCGACGACCTGCAGCGGCTCAAGGCCAAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGCAGATGCGGGAATTGGAGGACCGATTTGCCAGTGAGGCCAGTGGCTACCAGGACAACATTGCGCGCCTGGAGGAGGAAATCCGGCACCTCAAGGATGAGATGGCCCGCCATCTGCGCGAGTACCAGGACCTGCTCAACGTGAAGATGGCCCTGGATGTGGAGATTGCCACCTACCGGAAGCTGCTGGAGGGAGAGGAGAGCCGGATCAATCTCCCCATCCAGACCTACTCTGCCCTCAACTTCCGAGAAACCAGCCCTGAGCAAAGGGGTTCTGAGGTCCATACCAAGAAGACGGTGATGATCAAGACCATCGAGACACGGGATGGGGAGGTCGTCAGTGAGGCCACACAGCAGCAGCATGAAGTGCTCTAAAGACAGAGACCCTCTGCCACCAGAGACCGTCCTCACCCCTGTCCTCACTGCTCCCTGAAGCCAGCCTTCTTCCATCCCAGGACACCACACCCAGCCTCAGTCCTCCCCTCACAGCCTCTGACCCCTCCTCACTGGCCATCCCTCGTGGTCCCCAACAGCGACATAGCCCATCCCTGCCTGGTCACAGGGCATGCCCCGGCCACCTCTGCGGACCCCAGCTGTGAGCCTTGGCTGTTGGCAGTGAGTGAGCCTGGCTCTTGTGCTGGATGGAGCCCAGGCGGGAGCGGTGGCCCTGTCCCTCCCACCTCTGTGACCTCAGGCACTAGCCTTTGGCTCTGGAGACAGCCCCAGAGCAGGGTGTTGGGATACTGCAGGGCCAGGACTGAGCCCCGCAGACCTCCCCAGCCCCTAGCCCAGGAGAGAGAAAGCCAGGCAGGTAGCCAGGGGGACTAGCCCCTGTGGAGACTGGGGGGCTTGAAATTGTCCCCGTGGTCTCTTACTTTCCTTTCCCCAGCCCAGGGTGGACTTAGAAAGCAGGGGCTACAAGAGGGAATCCCCGAAGGTGCTGGAGGTGGGAGCAGGAGATTGAGAAGGAGAGAAAGTGGGTGAGATGCTGGAGAAGAGAGGAGAGGAGAGAGGCAGAGAGCGGTCTCAGGCTGGTGGGAGGGGCGCCCACCTCCCCACGCCCTCCCCTCCCCTGCTGCAGGGGCTCTGGAGAGAAACAATAAAGAGATTCACACACAAGCCAAGCTGGCCCCTGTTGTCTTGACTGCCAG