Transcript asmbl_68458

Sequence
Transcript Sequence for observation asmbl_68458 of TGE0057806:
GACCAGCTGCTTTCAAGGGACGTGCCCGTCAGGAGGGAGGGTGGCCAGCCCCCAGGCAGCCCTGACTGTGTGCTCCCCTCCAGGCTGAAACTGCCGCCAACCGGATCTGTAAGGTGCTGGCTGTCAACCAAGAGAACGAGCACCTGATGGAGGACTACGAGAAGCTGGCCAGCGACCTCCTGGAGTGGATCCGGCGCACCATCCCCTGGCTGGAGGACCGTGTGCCCCAAAAGACTATCCAGGAGATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGTGTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCCGCCTTCATGCCCTCCGAGGGCAAGATGGTCTCGGACATCAACAATGGCTGGCAGCACTTGGAGCAGGCTGAGAAGGGCTACGAGGAGTGGCTGCTGAATGAGATCCGCAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGGAAGGAAGCCATGCTGAAGCACCGGGACTACGAGACGGCCACACTATCGGACATCAAAGCCCTCATTCGCAAGCACGAGGCCTTCGAGAGCGACCTGGCTGCGCACCAGGACCGCGTGGAGCAGATCGCCGCCATTGCCCAGGAGCTCAACGAGCTGGATTACTACGACTCCCACAATGTCAACACCCGGTGCCAGAAGATCTGTGACCAGTGGGACGCCCTCGGCTCTCTGACACATAGTCGCAGGGAAGCCCTGGAGAAAACAGAGAAGCAGCTGGAGGCCATCGACCAGCTGCACCTGGAATACGCCAAGCGCGCGGCCCCCTTCAACAACTGGATGGAGAGCGCCATGGAGGACCTCCAGGACATGTTCATCGTCCATACCATCGAGGAGATTGAGGGCCTGATCTCAGCCCATGACCAGTTCAAGTCCACCCTGCCGGACGCCGATAGGGAGCGCGAGGCCATCCTGGCCATCCACAAGGAGGCCCAGAGGATCGCTGAGAGCAACCACATCAAGCTGTCGGGCAGCAACCCCTACACCACCGTCACCCCGCAAATCATCAACTCCAAGTGGGAGAAGGTGCAGCAGCTGGTGCCAAAACGGGACCATGCCCTCCTGGAGGAGCAGAGCAAGCAGCAGTCCAACGAGCACCTGCGCCGCCAGTTCGCCAGCCAGGCCAATGTTGTGGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGCGCATCTCCATTGAGATGAACGGGACCCTGGAGGACCAGCTGAGCCACCTGAAGCAGTATGAACGCAGCATCGTGGACTACAAGCCCAACCTGGACCTGCTGGAGCAGCAGCACCAGCTCATCCAGGAGGCCCTCATCTTCGACAACAAGCACACCAACTATACCATGGAGCACATCCGCGTGGGCTGGGAGCAGCTGCTCACCACCATTGCCCGCACCATCAACGAGGTGGAGAACCAGATCCTCACCCGCGACGCCAAGGGCATCAGCCAGGAGCAGATGCAGGAGTTCCGGGCGTCCTTCAACCACTTCGACAAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGGTGGGT