Transcript asmbl_66251

Sequence
Transcript Sequence for observation asmbl_66251 of TGE0056827:
GCGCCATCTTGCAGCCGGCGGCGCGGATTGAATGAGCCCGCCGAGCCCGGGCCGCCGTCGGGAGCAGCGCAGGCCGCGAGCCGCCGCCACCATGGCCACGCCGCTGCCCGGCCGCGCGGGCGGGCCCGCCACGCCGCTGTCGCCCACGCGCCTGTCGCGGCTGCAGGAGAAGGAGGAGCTGCGCGAGCTCAACGACCGCCTGGCGCACTACATCGACCGCGTCCGCGCGCTGGAGCTGGAGAACGACCGGCTCCTGCTCAAGATCTCAGAGAAGGAGGAGGTGACCACGCGCGAGGTGAGTGGCATCAAGGCGCTGTACGAGTCGGAGCTGGCCGATGCCCGGAGAGTCCTGGATGAGACGGCTCGAGAGCGTGCCCGGCTGCAGATAGAGATTGGGAAGCTGAGGGCAGAGTTGGACGAGGTCAACAAGAGCGCCAAGAAGAGGGAGGGCGAGCTTACGGTGGCCCAGGGCCGTGTGAAGGACCTGGAGTCCCTGTTCCACCGGAGCGAGGTGGAGCTGGCAGCTGCCCTCAGCGACAAGCGCGGCCTGGAGAGTGACGTGGCTGAGCTGCGGGCCCAGCTGGCCAAGGCCGAGGACGGTCATGCAGTGGCCAAAAAGCAGCTGGAGAAGGAGACGCTGATGCGTGTGGACCTGGAGAACCGCTGCCAGAGCCTGCAGGAGGAGCTGGACTTCCGGAAGAGTGTGTTCGAGGAGGAGGTGCGGGAGACGCGGCGGCGGCACGAGCGGCGCCTGGTGGAGGTGGACAGCAGCCGGCAGCAGGAGTACGACTTCAAGATGGCACAGGCGCTGGAGGAGCTGCGGAGCCAGCACGACGAGCAAGTGCGGCTCTACAAGCTGGAGCTGGAGCAGACCTACCAGGCCAAGCTGGACAGCGCCAAGCTGAGCTCTGACCAGAACGACAAGGCGGCCAGTGCGGCTCGCGAGGAGCTGAAGGAGGCCCGCATGCGCCTGGAGTCCCTCAGCTACCAGCTCTCCGGCCTCCAGAAGCAGGCCAGTGCCGCTGAAGATCGCATTCGGGAGCTGGAGGAGGCCATGGCCGGGGAGCGGGACAAGTTCCGGAAGATGCTGGACGCCAAGGAGCAGGAGATGACGGAGATGCGGGACGTGATGCAGCAGCAGCTGGCCGAGTACCAGGAGCTGCTGGACGTGAAGCTGGCCCTGGACATGGAGATCAACGCCTACCGGAAGCTCCTGGAGGGCGAGGAGGAGAGGCTGAAGCTGTCCCCCAGCCCATCCTCGCGCGTCACCGTCTCACGAGCCACCTCGAGCAGCAGCGGCAGCTTGTCCGCCACCGGGCGCCTGGGCCGCAGTAAGCGGAAGCGGCTGGAGGTGGAGGAGCCCTTGGGCAGCGGCCCAAGCGTCCTGGGCACGGGCACGGGTGGCAGCGGTGGCTTCCACCTGGCCCAGCAGGCCTCGGCCTCGGGTAGCGTCAGCATCGAGGAGATCGACCTGGAGGGCAAGTTTGTGCAGCTCAAGAACAACTCGGACAAGGATCAGTCTCTGGGGAACTGGAGAATCAAGAGGCAGGTCTTGGAGGGGGAGGAGATCGCCTACAAGTTCACGCCCAAGTACATCCTGCGCGCCGGCCAGATGGTCACGGTGTGGGCAGCTGGTGCGGGGGTGGCCCACAGCCCCCCCTCGACGCTGGTGTGGAAGGGCCAGAGCAGCTGGGGCACGGGCGAGAGCTTCCGCACCGTCCTGGTTAACGCGGATGGCGAGGAAGTGGCCATGAGGACTGTGAAGAAGTCCTCGGTGATGCGTGAGAATGAGAATGGGGAGGAAGAGGAGGAGGAAGCCGAGTTTGGCGAGGAGGATCTTTTCCACCAACAGGGGGACCCGAGGACCACCTCAAGAGGCTGCTACGTGATGTGAACCCACACTCCTCATCCACACACCTTTCTTTACCCAGAGCCACTGAAAACTATTTTTATATCATTGGCTTTCTTTAGTTCTTGATACATTTCTAGAGAATTTCTAAGCGAACTGCCAGAACGTGTGGGTGGGTCTCCCCCAGCCCTCCCTCCTGGCGGGTCTCCTCCAGCCTCACTTCGCTGCCACTTCGCCGCTGCCCCGGAGACTTTTCAATCCCACCCCACTCCTCATCTCACCATTTGGTCAAATTGGAAGCCCAGGGCCAGGACCCGGAGGTTTAGAAGATGCTTGGGCTTGGAGGGAGGAGGGCCGGCGAGGCTAGCGAGGGGACAGGAGACGGCCCTGCTGCGGACGGAGCGCGGAAACTGCGTAGGAATTCAGTGGTGGTGGGTTTTTTTAAGGCTTTCTACAAAACCAAATTCAGAATCCAGGCGTCGACCTGGTGGGGCCCGGGGCCAAGCCTGCATTCTGGCTGCCCAGCTTCGGACAGCGGGAACTCCTCAGGCAGCCACGCAGCGGGTGTGGGCCAGCATGGGGATGGCGTGGCCCCCAGGGCGGGTTTTCACTCCGCTGCCTGGGCTTCCAGATTCCCGTTCTGGCAGCGCACCGGCCGGGTTTCTCGGACCGTTGACTTTATTTGGGGGAGTTTTCCCGCAGTTCAGTTCCTGACTGTGCAAGGCCAACAGGGCAGGGGAGGGGAAGACCTGGGGAAGGAAGAATGAGGACAGTCCCGTCGTAAGACCTGTCACAACAATAAGCAGGGAGGGGAGATGTGGAGGGGACACATCTGGTTGCCTTGGAGGCAGAAGCTGTGAGTTTCAGAACAGCTGTCTGCAGGGAACGCCACCATGTTGACCCTCTGGAGGAGAGCGCTGTGGAGCCCCTCCCGTGTTCCAGCTCCGTCTGCCCTGTGCCTATATATACACATGCGTCTATCCATACTGTGCTTTTATCTGTGATTTTCTCGCTGAAACCATGTTTCTCAGACAGGCCAAGGCCACCTGACTCCTATCACGACGCACCCAAGCCCCTCAGTCCAGCTTCCCAATGCCTGGCACCCCCCTTCGGCAATAGCTCACCGTTTACACCCTCCCTCATAGATACACAGAAGTTATTTTTTTAATGGATATTTATTTTTTTACATTGGTCAGTACACAGGTCAGGAGCTCACGCCAGGGCCTTGAGGACAGGCTGACCCTCCTCCCCGGGGTGGCGTGGGGCTGGGGCACCCTCCGACGGCAGAGCCTCCTTCAGAAAGTGCAGCTCAAGTCTTAAAGACACCAAAACTGAGCCATGGGCACGCGCCGTCTCCGGGCCATGGCGTTCACTGCAGGGCGGGGGCGGCACCGCTCCCCTGTGACTGCATCCCGCCTCCCTGGGGACCTGCCTGTGGCAGGAAGGAATGGGGGGCCCCAGCCCCAGGCCGGGAAGGAGCCAGCGGCCGACAAAGCAGAAACACCCGCTGCTCCACGTAGCCCCTGCTCGCTGTCCTTGCTCTCAGAAGTCCCGGTCCCATGTAGATAGAGGGGGGCGCATCTTACCAAAGCATTTCCTCCTGGAGGCTACGCCGCTGTGCTCCCAGTCAGGCGGCTGGTAGGGAGCTTTGCCTGCCCCGGGGATACCCTCTGCCAGCCGCTGGAAGTGGGAATGCTGGCGACAGACTGTGTCCTCTTTCCCACCTTCATAGCAGGAATCACCCGGACCCGACTGGCTGGGCTTCGTGCTAGCGAGGGTTCTGGGGGTGGGTCTTGGTGATCTTGTCCTATGGGGAGTCTGCAGTGGTCTCAGCCACATCCTATGTATTTTGGCTCTGGAGGAGCAAAGCTGTATCCTGGAGTTGGTCTGTGATTTGCCGACAGCCTTGCAGGCTGGGCTCAGGGACAAAGTCCCCCCCAAAACCCGCAGGTCCTCATGTCCAGACGCTGCCCAGTCCTGTCCTGAAAACAGCACGCCCCAGGCCCACAGAACCCCCCACCCTACATTTGCCTTGGGTGGAGCTGGGGGTGGTCCTAGGACTGCGGGTGCCCTTAGCTGAAGGGGGTGGGGAGAAGCGTGGACTGGGCAGCCTGTGGGTAATTGGAGGTTCATTGAGAATTGAGTCTTTGGAAACACTAAGAAAATCAAATTTTTAAAAGTTATTTATGGCCTGGGAAACAATTTGCATTTGTCCCCAAATACGCTTAGCTGTGTGCCGCTTAGAACGATGCGAAACCATCCCTCTGTGTAAGCCCGTGCCGTGTGACTCGAAGCCTAGCGCCCTCCCTGCGAAGCATCAGACGCCACCCAGCCCTGGGGGGAGGCCCACGCCTGCTGGACCAACGCGGGTTCTGGGGTGCACAGCGCCAGGTTAACGCTGAAGCCTGCCCCGCTGAGCCCAGGAGCCGGGAGGCCTGCGGGCTGACCCAGAATCCGATCATGCACCTGTCCTCATGCCAGCGGCTTTGGCTGGGGTTGGTCTGAAGCCTGCACGCGGCAGTTCTTTGTTAAAGATCTGAGGGACTCCTCAGTCCTGGGGCGTCGCCGCCTGCAGCCTCTTCCAAGCCCTGCGTCCAGCGAGCGTCACAGCACAACCTGCAAAAACGGAGCTGGGCTGCAGCTGGGGCTGGCATGGACTTTCATTTCAGAGATTCGGTTTTTAAGAAGATGCATGCCTAATGTGTTCTTTTTTTTTTCCAATGATTTGTAATATACATTTTATGACTGGAAACTTTTTTGTACAACACTCCAATAAACATTTTGATTTTA