Transcript asmbl_63669

Sequence
Transcript Sequence for observation asmbl_63669 of TGE0000943:
GGCGGAAGTCCCGGATTGAGGCGCCGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCCTGCCGGAGCCGCTGCCGCTATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATACGACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAAGAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGGAGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAAATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATTCTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTCTATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGACAGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATGACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTCTACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGATGATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATCATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAAGAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGAGACATAAGCCAACAAGAGAAACCATCTCTGACCACCCCCTCCTCCCCATCCCACCCTTTGGAAACTCCCCATTGTCACTGAGAACCACCAAATCTGACTTTTACATTTGGTCTCAGAATTTAGGTTCCTGCCCTGTTG