Transcript asmbl_61720

Sequence
Transcript Sequence for observation asmbl_61720 of TGE0000943:
GGCGGAAGTCCCGGATTGAGGCGCCGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCCTGCCGGAGCCGCTGCCGCTATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATACGACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAAGAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGGAGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAAATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATTCTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTCTATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGACAGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATGACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTCTACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGATGATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATCATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAAGAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGAGACATAAGCCAACAAGAGAAACCATCTCTGACCACCCCCTCCTCCCCATCCCACCCTTTGGAAACTCCCCATTGTCACTGAGAACCACCAAATCTGACTTTTACATTTGGTCTCAGAATTTAGGTTCCTGCCCTGTTG