Transcript asmbl_55302

Sequence
Transcript Sequence for observation asmbl_55302 of TGE0058311:
CAGATCGCTGACCTCCAGGCGCAGATCGCAGAGCTCAAGATGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGCGGCCCTGGCCAGGCTTGACGATGAAATCGCTCAGAAGAACAATGCCCTGAAGAAGATCCGGGAGCTGGAGGGCCACATCTCAGACCTCCAGGAGGACCTGGACTCAGAGCGGGCCGCCAGGAACAAGGCTGAAAAGCAGAAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGACACACTGGACAGCACAGCCACTCAGCAGGAGCTCAGGGCCAAGAGGGAGCAGGAGGTGACGGTGCTGAAGAAGGCCCTGGATGAAGAGACGCGGTCCCATGAGGCTCAGGTCCAGGAGATGAGGCAGAAACACGCACAGGCGGTGGAGGAGCTCACAGAGCAGCTTGAGCAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAGCAGACGCTGGAGAAAGAGAACGCAGACCTGGCCGGGGAGCTGCGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGCAGTCCAAGTGCAGCGATGGGGAGCGGGCCCGGGCGGAGCTCAATGACAAAGTCCACAAGCTGCAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTACGAAGCTGCGCCAGCTGGAGGAGGAGCGGAACAGCCTGCAAGACCAGCTGGACGAGGAGATGGAGGCCAAGCAGAACCTGGAGCGCCACATCTCCACTCTCAACATCCAGCTCTCCGACTCGAAGAAGAAGCTGCAGGACTTTGCCAGCACCGTGGAAGCTCTGGAAGAGGGGAAGAAGAGGTTCCAGAAGGAGATCGAGAACCTCACCCAGCAGTACGAGGAGAAGGCGGCCGCTTATGATAAACTGGAAAAGACCAAGAACAGGCTTCAGCAGGAGCTGGACGACCTGGTTGTTGATTTGGACAACCAGCGGCAACTCGTGTCCAACCTGGAAAAGAAGCAGAGGAAATTTGATCAGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATGAGAGGGACAGAGCTGAGGCAGAAGCCAGGGAGAAGGAAACCAAGGCCCTGTCCCTGGCTCGGGCCCTTGAAGAGGCCTTGGAAGCCAAAGAGGAACTCGAGCGGACCAACAAAATGCTCAAAGCCGAAATGGAAGACCTGGTCAGCTCCAAGGATGACGTGGGCAAGAACGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACGCAGCTGGAAGAGCTGGAGGACGAGCTGCAAGCCACGGAGGACGCCAAACTGCGGCTGGAAGTCAACATGCAGGCGCTCAAGGGCCAGTTCGAAAGGGATCTCCAAGCCCGGGACGAGCAGAATGAGGAGAAGAGGAGGCAACTGCAGAGACAGCTTCACGAGTATGAGACGGAACTGGAAGACGAGCGAAAGCAACGTGCCCTGGCAGCTGCAGCAAAGAAGAAGCTGGAAGGGGACCTGAAAGACCTGGAGCTTCAGGCCGACTCTGCCATCAAGGGGAGGGAGGAAGCCATCAAGCAGCTACGCAAACTGCAGGCTCAGATGAAGGACTTTCAAAGAGAGCTGGAAGATGCCCGTGCCTCCAGAGATGAGATCTTTGCCACAGCCAAAGAGAATGAGAAGAAAGCCAAGAGCTTGGAAGCAGACCTCATGCAGCTACAAGAGGACCTCGCCGCCGCTGAGAGGGCTCGCAAACAAGCGGACCTCGAGAAGGAGGAACTGGCAGAGGAGCTGGCCAGTAGCCTGTCGGGAAGGAACGCACTCCAGGACGAGAAGCGCCGCCTGGAGGCCCGGATCGCCCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGGGCAACATGGAGGCCATGAGCGACCGGGTCCGCAAAGCCACACAGCAGGCCGAGCAGCTCAGCAACGAGCTGGCCACAGAGCGCAGCACGGCCCAGAAGAATGAGAGTGCCCGGCAGCAGCTCGAGCGGCAGAACAAGGAGCTCCGGAGCAAGCTCCACGAGATGGAGGGGGCCGTCAAGTCCAAGTTCAAGTCCACCATCGCGGCGCTGGAGGCCAAGATTGCACAGCTGGAGGAGCAGGTCGAGCAGGAGGCCAGAGAGAAACAGGCGGCCACCAAGTCGCTGAAGCAGAAAGACAAGAAGCTGAAGGAAATCTTGCTGCAGGTGGAGGACGAGCGCAAGATGGCCGAGCAGTACAAGGAGCAGGCAGAGAAAGGCAATGCCAGGGTCAAGCAGCTCAAGAGGCAGCTGGAGGAGGCAGAGGAGGAGTCCCAGCGCATCAACGCCAACCGCAGGAAGCTGCAGCGGGAGCTGGATGAGGCCACGGAGAGCAACGAGGCCATGGGCCGCGAGGTGAACGCACTCAAGAGCAAGCTCAGAGGGCCCCCCCCACAGGAAACTTCGCAGTGATGCACCAGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCAACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTCACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGGTGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAGCCAGGA