Transcript asmbl_36200

Sequence
Transcript Sequence for observation asmbl_36200 of TGE0056195:
GAGTTTGTGGGTCAGAGTTTGTGGGTCAGAGTTTGTGGGGCTGGGATAGAAACTCGGGGGATTGGCGTTCAGATGCTGACCACTTCCCTCTTCTCTGAGCAGTGTGACTTCACCGAAGACCAGACCGCAGGTAGGTTATCTCTGATCCCTACCGAGGTCACCCTTAGGGAGAGGGACACCCTCCCCCCAGCACCTATCCTCTAATCTTAATCTGTCATCTCTTTAGCACCCCCATGAGATTACCCCCTGGATTATTTTCTCTTCTTCTGGATCCTCCATTTTCTTTTCTCACTTTCTTCCTCCCTCCCCTTCCACTCTAGATCTGATCCCAAGCACTGGGTGAGTTTTAGGTGGTGTGGGTATGTGAAAAAACTTGGTCACTTAATGCCTGCTGTGTGTGGGGTCTCGGGAGGGTGTATAAAGCTGCCTGCTTTCCTTTGTCCTTTAATCAGCTACTTCTGCCTCTTTTCTCCTCTTGTGATAACTGTCCCCGCCCTCCCAGCTTGCAGTTGTGAAGATTGTAGAGCAGTGACCTGATATTCTGTGCAGATGGGGACAAGACAGGGGAGTTTGCTAAGGATATGACTGTAGCTATACCCTCTGGAAGTTCTCTTTATACTGGAGGGGTGCGAAGTGGCAGGTTGGGATGACCCTAGTCCCAGGCTGCTGCTCCCACTTCCTTATAAGGACAGGACTGAGACTGGGCGGTGGCGAATTCCTGCCCTGAGAAGTGTAGTAGCAGCAGTGGAGATTGGCAGGCCTGCCGCAGGCAGAGGGGTTGTGTAAATGGATGTTACCAGGCTGCCAGAAGGGGAGGAAGCCTCTATATAGAACACTTGAGTTGGGAGGAAGAGAAATAGAGCCCTCTTAAGTAGACTTTGGTGTACAGTTTGGTGCAGATATCTCGTTTCCTCAGCATGATCAAAGTTGAATGGGCAGCAGAGCTCTGAGGTAGGGTTTGGATTAACCCTCAAATCCTGTGTTGACATTCATCTGAATCCTCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGGTAAGAGGTGAACTGCGCTTTCTCAGAGAAAGCAGCCATATGGGGCAGGTCAAGTATAGTGTCTGGGGCTTTCCCTATCCCTGGACTTGGGCTCCAAAAAGAGCCAGGAGGCAAGGTGCAGGGCCCTGCCCAGCCCAGCCCAGGAGTGGGAGGTCAGGGCGGTATAACAGGAAAGGAAGGGGGTAGTATTGTAGAGGGTGGGAAGGAATGAGAAGTGAAATAATGGAATGTCTGTCCCCACTGCCTGACCCCTCACCCCATGTCTTTGTCTTGTCTTCACCATGAATGTCTCTTCCTTCCTGCAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGGTGCAGGGGTTGAGGAAAGCTGGGGGAGGCCCTGTACTAGCCATCTGGGCTTCATTTAAAAACTACTGGCCCCATTCATCCATCTTACACAAGCTACCTCTTGGGAGATTAGGAAAGCCATAGATCCCAGTAGGACTAAGGCTGGCCATCCCTGTTCCATTCCATATCAGGCTGTCTTCTCCTACCCTTCCAGCTCCTTAAATCTGGCCCCCGCCCTCCCAAGCTCCCAATAAGGCCTTTTGTGGGGAAGCCTGTGGAGTGTTTATTGGAGCTAAAGCCAGGCCATTATTAGCACTGCCTAAGCCTGTCCGTCACCTCAGCAGGGTGAAGGGCCAATTATAACAAAAGTAGGTAAGGGGCTTGCCTCCTCTCTAATAAGGGAAGGAGTGAAACCACTACTTCTGAAGGGACAGAGATACAAAATTCCATGTTGTGGGAATGTCCTTCCAAGTCTTAAACAGCTTTTAGGGCAGGTGAGAGCCTCTGCTCCTATACCAGCACATAGTCTCGACAGTTGTGCTGCCGTTCGTGTTTTGTGGGGAG