Transcript asmbl_22917

Sequence
Transcript Sequence for observation asmbl_22917 of TGE0004263:
CCTGCCTGCCTGCCCTCTTGCTGTGCTCCTGCTTAAAGAAATCAGTCCTTCCTGTCCGACTTAGTCCTAGGAAGAAGTTTCAGCCTACGAGATATCATTAAAACATTCCAAGATCATCCAGTCGAATTCTACAGGGATTGGCGATCAACCGGAACACTCTGACGTGGATATCTGATTGCTTACCTGTCCAGACATCATCTGGTCTCCTTAAACCTGAAACCACACCATGGATGACTTTGAACGTCGCAGAGAACTTAGGAGGCAAAAACGGGAAGAGATGCGCCTGGAAGCAGAAAGAATCGCCTACCAGAGAAACGACGACGATGAGGAAGAGGCCGCCCGGGAACGGCGCCGCCGAGCCCGACAGGAAAGGCTGCGGCAGAAGCAAGAGGAAGAATCTTTTGGGCAGGTGACTGACCAGGTGGAGGTTAACGCCCAGAACAGTGTGCCTGACGAGGTCAAGACAACCACGGCGAACACTCAGGTGGAGGGCGACGACGAGGCCGCGTTCCTGGAGCGCCTGGCTCGGCGGGAGGAGAGACGCCAAAAACGCCTCCAAGAAGCTCTGGAGCGGCAGAAGGAGTTCGACCCCACAATAACGGATGCAAGTTTGTCGCTACCAAGCAGAAGAACGCAAAACGACACAGAAGAAAACGAACATGCAGAGAAGGAAGAAATCAGTGAAAGTCGCCAAGAAAGATACGAGATAGAGGAAACAGAAATAGTCACGAAGTCCTACCAGAAGAACGACTGGAGGGTTGCTGAAGAGAACAAGAAAGACGAAAAAGAAAAGGAGGGAGAGGAAGAAGAGAAGCCAAAGCCAGGGAGCATCAAGGAAAATCAGATCAAAGATGAGAAGATGAAAAAGGACAAAGAGCCCAGGGAAGATGTTAAGAGCTTCTTGGATGGAAAGAAGGGATTCACAGAAGTCAAGTCGCAGAATGGAGAATTCGTGACCCACAAACTTAAACACACTGAGAATACTTTCAGCCGTCCCGGAGGGAGGGCTGGCGAGGCCAAGGAGGCGGAGGGCGCGTCCCAAGTGGAAGCGGGCAAGCGCCTGGAGGAGCTGAGGCGCCGCCGTGGGGAAACCGAGAGCGAAGAGTTCGAGAAGCTCAAACAGAAGCAGCAGGAGGCAGCCCTGGAGCTCGAGGAGCTGAAGAAAAAGCGGGAGGAGCGAAGGAAGGTTCTGGAGGAGGAGGAGCAGAGGAGGAAGCAGGAGGAAGCCGATCGAAAAGTCAGAGAGGAGGAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGGGCAGAAGCTGCTGAGAAACGCCAGAAGATGCCAGAGGATGGGTTAGCAGATGACAAGAAGCCATTCAAATGTTTCACTCCTAAAGGTTCATCTCTCAAGATAGAAGAGCGAGCAGAATTTTTGAACAAGTCTGTGCAGAAAAGTGGTGTCAAATCAACTCATCAGGCAGCAGTTGTCTCCAAGATTGACAGCAGACTGGAGCAATACACCAGCGCCATCGAGGGAACGAAAACCGCAAAACCTACAAAGCCAGCAGCCTCGGATCTTCCGGTTCCTGCCGAAGGTGTTCGCAACATGAAGAGCATGTGGGAGAAAGGGAATGTGTTCTCATCCCCCGCTGCGTCGGGCACGCCAAACAAGGAAACTGCTGGCTTGAAGGTGGGGGTTTCCAGCCGCATCAATGAATGGCTAACCAAAACCCCAGATGGAAACAAGTCACCTGCTCCCAAACCTTCAGATTTGAGGCCAGGAGACGTATCTGGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGATAAGGTCACATCCCCCACTAAGGTCTGAGACAGTTGAAGAAAGAACCCCAGAGTAGCCACTCAAGATGCTGGACCAGCTCAGCTGAAGAGGGTTAATGTGCTCTGTTTTATATTTATGTTGATTTACTAAATTGGGTTCATTTCCTTTTGTTTTATTTTCCATTATCCCGGTAAACCTATGTATATTATCACCATATTTAATAATCACAGTCTAGAGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAACGAAACCCATGCTGTGAAATAGAGACTTTTCTACTGATCATCAGAACTGTGTGTGAACAGTGATACCAACCACATTGGAAGTCAAACAAAAGGAGATTCAAGTTGAAAATTGCCTGAGGAATGTGTGCAGTATCCAGAAAAATGAACCGTAGTGGGTTTTGGGTTTTTTTTTTAATTTTAAATACAAAAGTCATGTTGTTTCTGCACTTTAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTCTGAAACTAATTCATTTCAGATTTGAGATACTATAATGATGATTGTCTTTTTAAAAAAAATGTATTGTTAAGGTATTACTTTTTTCATGCTGATGAATATCTAAATCGGATAAGGATTTTAGCTGACAGGGGTACTGATTTATTTAGGTTGGTTGCTTTGTGGATTTCTTTGGTAGTGATAGTGAACCACATTTTAGATGACCTGATCATATATGTATGTGCATACACATATACAAACACACTAATGGTAGAAAGCTTTTTCATGTGCTAGACTATTGTATTTAGCAGTATGTCCTTGTAACTAGACAATATCACAGCTTTTTAAAAATTACAAATCACAATATTCTATTAATATTTCATATTTGCCAATGGAGACATGGCAGAATAGGTATCGATATGTTTTCGATGCCCGATAGATGACCTATAAGGAAAAAGAGAGATTAGAAATATCAAAATGTCAGTTTATAGAATCAACATTTTCTATGAAACATAATATTTAGCTTATAATTAAAGGCAATCTTGAAGGCCAATGTGAATTTTACTAAATCTACCATCTGGATCAAACTCAAAGCTTGCCCAAAACTTTATTCTGTTAATAAGCGAGTTCACAATAGGTTGGCCTAAATGATACCTGAGGTCTCTTCCTTTTTTCAAATTTAAAGACAAGAATTTTAGTGACAAGATTGTGCAGACTGAAATTCCATGGACAGGTATACAAAGACCAACTTTGGCTAATGTCTAGAAGCAGGGAAGAAAAGTAAGCAAAACCCACTGTTTAGAAGTCATGACAATACTTCCATCTTTAATATACTGAACCAATTTTTAAATTAAACTTTTCTACTTATATTATTAGTCATTGGTACTTATCATAAGTTGATAATGTGTCGAACTTTGAAGAAGTATATATAACTTTTATTAGTTTTATCTTTTTCCCCAAGAGTCTTCACCAACTCATCATTTTTACACAATCCAGATATCAGATCTTATTTTAGCTTATACGTGTCCATCTGTTCTTCCCAATAGATGATAAGAGTACTCCAGTGTCTTGGAAATATGTTCTAGCATAGAGATATATAGGGTAGTTCTATAAACTTATACCTCATTTGACTTAACCAAAATGGTCCTAGTCTCAATTCCTACCACAATGAGGGAACCTCCCAAATGACTCTTTTCTAGCTCTTTTTTGGAAGAGCTAGCCAGGGCAGTGCTGGCATGAAGAGTGACCACTGCCTGACAAAGTCTATCTTCCTCAAAAATTAGTAAAGAGTAATTGAATTCTCTAGCTTTTAGCGCACCTGGGACAAAGCAAGGAAAGCCGCCTAGACTGCACAAATCATCTGCCCAAGACAGAGTAGATATGAGTCTGTGATAAGATGAACTATAATCCACAAGTAGTGCCTGATTTAGCATTGACTCCCATCATTGGGATGAAACAGATCAAAGTTTGAATTAAGGCCCATGGCGATGTAACATTGCTTTGTTGTACTTTTGAACAAGAGCTTCGCCTGATCACTATTATATATGTTTTTCTAGAAAATCTAAAGTTGAGAAGAGAATATGTCGATCCTGACTTTTATTCCAATATTTGGATGGAATAAATTTTAGGGTAGAATTTTGTTTAGTTTGGATTTAATCTTTTGAAAAACAAATTCTTTGTTTACCTGTTTGATTACAACGCTCTTTGTTATCTTTAAGAGGTAAAGCTGCAAAGTGACTAGCATGTTCTGTGAATCTGCCATTCCTAAAAATTTTATAAACACTTGATATTTGTCACTGATAATTGATCGCTGCAATAAATATGTATTGTGAAAAAGCATCCACAATAAATGGAATTCCTCCAAA