Transcript asmbl_34602

Sequence
Transcript Sequence for observation asmbl_34602 of TGE0056499:
GCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGATTCCTTCAACACCTTCTTCAGTGAGACGGGGGCTGGCAAGCATGTGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACCATTGGCAAGGAGATCATTGACCTTGTGTTGGACCGAATTCGCAAGCTGGCTGACCAGTGCACCGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCCCTGCTCATGGAACGTCTCTCAGTTGATTATGGCAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCACCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGACATCTGTCGTAGAAACCTCGATATCGAGCGCCCAACCTACACTAACCTTAACCGCCTTATTAGCCAGATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCTCTGGCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAAACCAAGCGCAGCATCCAGTTTGTGGATTGGTGCCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTGGCCAAGGTACAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAAGATATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAGGAATACTAATTATCCATTCCTTTTGGCCCTGCAGCATGTCATGCTCCCAGAATTTCAGCTTCAGCTTAACTGACAGACGTTAAAGCTTTCTGGTTAGATTGTTTTCACTTGGTGATCATGTCTTTTCCATGTGTACCTGTAATATTTTTCCATCATATCTCAAAGTAAAGTCATTAACATC