Transcript asmbl_28545

Sequence
Transcript Sequence for observation asmbl_28545 of TGE0000090:
GTTTTGAGGGAGGTCTTTGGCTTTTTTTGGCGGAGCTGGGGCGCCCTCCGGAAGCGTTTCCAACTTTCCAGAAGTTTCTCGGGACGGGCAGGAGGGGGTGGGGACTGCCATATATAGATCCCGGGAGCAGGGGAGCGGGCTAAGAGTAGAATCGTGTCGCGGCTCGAGAGCGAGAGTCACGTCCCGGCGCTAGCCCAGCCCGACCCAGAATGAAAAAGGCAGGCATTGACCTCCCTCTGAGGCAGTTTCCAGGCCCACCGTGGTGCACGCAAACCACTTCCTGGCCATGCGCTCCCTCCTGCTTCTCAGCGCCTTCTGCCTCCTGGAGGCGGCCCTGGCCGCCGAGGTGAAGAAACCTGCAGCCGCAGCAGCTCCTGGCACTGCGGAGAAGTTGAGCCCCAAGGCGGCCACGCTTGCCGAGCGCAGCGCCGGCCTGGCCTTCAGCTTGTACCAGGCCATGGCCAAGGACCAGGCAGTGGAGAACATCCTGGTGTCACCCGTGGTGGTGGCCTCGTCGCTAGGGCTCGTGTCGCTGGGCGGCAAGGCGACCACGGCGTCGCAGGCCAAGGCAGTGCTGAGCGCCGAGCAGCTGCGCGACGAGGAGGTGCACGCCGGCCTGGGCGAGCTGCTGCGCTCACTCAGCAACTCCACGGCGCGCAACGTGACCTGGAAGCTGGGCAGCCGACTGTACGGACCCAGCTCAGTGAGCTTCGCTGATGACTTCGTGCGCAGCAGCAAGCAGCACTACAACTGCGAGCACTCCAAGATCAACTTCCGCGACAAGCGCAGCGCGCTGCAGTCCATCAACGAGTGGGCCGCGCAGACCACCGACGGCAAGCTGCCCGAGGTCACCAAGGACGTGGAGCGCACGGACGGCGCCCTGCTAGTCAACGCCATGTTCTTCAAGCCACACTGGGATGAGAAATTCCACCACAAGATGGTGGACAACCGTGGCTTCATGGTGACTCGGTCCTATACCGTGGGTGTCATGATGATGCACCGGACAGGCCTCTACAACTACTACGACGACGAGAAGGAAAAGCTGCAAATCGTGGAGATGCCCCTGGCCCACAAGCTCTCCAGCCTCATCATCCTCATGCCCCATCACGTGGAGCCTCTCGAGCGCCTTGAAAAGCTGCTAACCAAAGAGCAGCTGAAGATCTGGATGGGGAAGATGCAGAAGAAGGCTGTTGCCATCTCCTTGCCCAAGGGTGTGGTGGAGGTGACCCATGACCTGCAGAAACACCTGGCTGGGCTGGGCCTGACTGAGGCCATTGACAAGAACAAGGCCGACTTGTCACGCATGTCAGGCAAGAAGGACCTGTACCTGGCCAGCGTGTTCCACGCCACCGCCTTTGAGTTGGACACAGATGGCAACCCCTTTGACCAGGACATCTACGGGCGCGAGGAGCTGCGCAGCCCCAAGCTGTTCTACGCCGACCACCCCTTCATCTTCCTAGTGCGGGACACCCAAAGCGGCTCCCTGCTATTCATTGGGCGCCTGGTCCGGCCTAAGGGTGACAAGATGCGAGACGAGTTATAGGGCCTCAGGGTGCACACAGGATGGCAGGAGGCATCCAAAGGCTCCTGAGACACATGGGTGCTATTGGGGTTGGGGGGGAGGTGAGGTACCAGCCTTGGATACTCCATGGGGTGGGGGTGGAAAAACAGACCGGGGTTCCCGTGTGCCTGAGCGGACCTTCCCAGCTAGAATTCACTCCACTTGGACATGGGCCCCAGATACCATGATGCTGAGCCCGGAAACTCCACATCCTGTGGGACCTGGGCCATAGTCATTCTGCCTGCCCTGAAAGTCCCAGATCAAGCCTGCCTCAATCAGTATTCATATTTATAGCCAGGTACCTTCTCACCTGTGAGACCAAATTGAGCTAGGGGGGTCAGCCAGCCCTCTTCTGACACTAAAACACCTCAGCTGCCTCCCCAGCTCTATCCCAACCTCTCCCAACTATAAAACTAGGTGCTGCAGCCCCTGGGACCAGGCACCCCCAGAATGACCTGGCCGCAGTGAGGCGGATTGAGAAGGAGCTCCCAGGAGGGGCTTCTGGGCAGACTCTGGTCAAGAAGCATCGTGTCTGGCGTTGTGGGGATGAACTTTTTGTTTTGTTTCTTCCTTTTTTAGTTCTTCAAAGATAGGGAGGGAAGGGGGAACATGAGCCTTTGTTGCTATCAATCCAAGAACTTATTTGTACATTTTTTTTTTCAATAAAACTTTTCCAATGACA