Transcript asmbl_22291

Sequence
Transcript Sequence for observation asmbl_22291 of TGE0056488:
GGTATAAGAGGCAGGGTGGCGGGCGGAAACCGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCAGGCCTACACCCCAGCAACCATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACTCTTGTGTGGGTGTTTTCCAGCACGGAAAAGTCGAGATAATTGCCAATGATCAGGGAAACCGAACCACTCCAAGCTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCTTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCTATTGCTTACGGCTTAGACAAAAAGGTTGGAGCAGAAAGAAACGTGCTCATCTTTGACCTGGGAGGTGGCACTTTTGATGTGTCAATCCTCACTATTGAGGATGGAATCTTTGAGGTCAAGTCTACAGCTGGAGACACCCACTTGGGTGGAGAAGATTTTGACAACCGAATGGTCAACCATTTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTGTAAGACGCCTCCGTACTGCTTGTGAACGTGCTAAGCGTACCCTCTCTTCCAGCACCCAGGCCAGTATTGAGATCGATTCTCTCTATGAAGGAATCGACTTCTATACCTCCATTACCCGTGCCCGATTTGAAGAACTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCAGTAGAGAAAGCCCTTCGAGATGCCAAACTAGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTTCTACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGACTTCTTCAATGGAAAAGAACTGAATAAGAGCATCAACCCTGATGAAGCTGTTGCTTATGGTGCAGCTGTCCAGGCAGCCATCTTGTCTGGAGACAAGTCTGAGAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCCCTTGGTATTGAAACTGCTGGTGGAGTCATGACTGTCCTCATCAAGCGTAATACCACCATTCCTACCAAGCAGACACAGACCTTCACTACCTATTCTGACAACCAGCCTGGTGTGCTTATTCAGGTTTATGAAGGCGAGCGTGCCATGACAAAGGATAACAACCTGCTTGGCAAGTTTGAACTCACAGGCATACCTCCTGCACCCCGAGGTGTTCCTCAGATTGAAGTCACTTTTGACATTGATGCCAATGGTATACTCAATGTCTCTGCTGTGGACAAGAGTACGGGAAAAGAGAACAAGATTACTATCACTAATGACAAGGGCCGTTTGAGCAAGGAAGACATTGAACGTATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAAGGTGTCATCCAAGAATTCACTTGAGTCCTATGCCTTCAACATGAAAGCAACTGTTGAAGATGAGAAACTTCAAGGCAAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAATGAAATTATCAACTGGCTTGATAAGAATCAGACTGCTGAGAAGGAAGAATTTGAACATCAACAGAAAGAGCTGGAGAAAGTTTGCAACCCCATCATCACCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGGAGGAATGCCTGGGGGATTTCCTGGTGGTGGAGCTCCTCCCTCTGGTGGTGCTTCCTCAGGGCCCACCATTGAAGAGGTTGATTAAGCCAACCAAGTGTAGATGTAGCATTGTTCCACACATTTAAAACATTTGAAGGACCTAAATTCGTAGCAAATTCTGTGGCAGTTTTAAAAAGTTAAGCTGCTATAGTAAGTTACTGGGCATTCTCAATACTTGAATATGGAACATATGCACAGGGGAAGGAAATAACATTGCACTTTATAAACACTGTATTGTAAGTGGAAAATGCAATGTCTTAAATAAAACTATTTAAAATTGGCACC