Transcript asmbl_22911

Sequence
Transcript Sequence for observation asmbl_22911 of TGE0008576:
CCTCACCCTTTTCTGGGGTTTCCGTGCGGCACAGGGCTCCGTTGGTGCGCATCCAAGATGGCGACGCTGTTGGCGGTAAATTCGGCTGCTAGTCTATGGGGTCCTTACAAAGACATTTGGCAAATGGTGGGAAATGCTCTCTGGAGAAGACAACCCGAAGCTGTCCACCTGCTCGACATGATTCTGAAGAAACATAAGCCAGACTTCATCTCACTGTTCAAAAATCCACCAAAAAATGTTCAACAGCATGAGAAGGTTCAGAAGGCTAGTACAGAGGGAGTCGCCATCCAGGGTCAGCAAGGGACCCGACTGCTTCCGGAACAGCTCATTAAAGAGGCCTTTATCCTCAGCGATCTTTTCGATATTGGAGAACTGGCTGCTGTGGAGCTTCTCCTTGCTGGAGAGCACCAACAGCCACATTTTCCTGGCCTCACCAGAGGATTAGTAGCTGTCCTCTTATATTGGGATGGAAAGCGATGCATTGCAAATTCCCTGAAAGCCTTAATACAGTCTAGACGAGGAAAGACATGGACCCTCGAACTCAGTCCAGAGCTGGTTTCCATGACAACACGCTTTACAGATGAGCTGATGCAGCAAGGGTTGACTTATAAAATCCTTACTCTGGTGTCACAGATTGATGTGAACAATGAGTTTGAGAAACTACAGCGTGAGAGAGGTTTGGGCAGCGAAAAACATCGCAAAGAGGTTTCCGATCTCATCAAGGAGTGCAGGCAGTCTCTGGCAGAAAGCCTTTTTGCCTGGGCTTGCCAGTCACCATTAGGCAAAGATGACACTCTACTCCTTATTGGACATTGGAAAGAGTTTTTTTAAGAGTGACAGTTGAGGCTAATGGCTCATTGGATACAGTGAATCTGGCTCTTCTTATGGCACTTCTGTACTGTTTTGACATCAGTTTTCTAGAACAGAGCACAGAGGAACGTGATGACATGATTCATCAACTTCCACTATTGACAGAGAGACAGTATATTGCAACAGTTCACTCTCGCCTTCAAGACTCACAGCCTTGGAAACTGCCTGGACTGCAAGCCACTGTTAGACTTGCCTGGGCACTGGCACTGAGGGGAATATCTCAGCTACCTGATGTGACAGCTCTGGCTGAATTCACAGAAGCAGATGAAGCAATGGCAGAGCTCGCAATTGCTGACAATGTTTTCCTGTTCCTCACTGAATCCGTAGTAGTGTCAGAAAACTTCTATCAGGACGAATTTTATATTCGTAGAATCCATAATCTCATCACGGATTTCCTTGCACTTATGCCAATGAAGGTGAAGCAGTTGAGGAATCGGGCAGATGAAGATGCTCGAATGATTCACATGAGTATGCAGATGGGTAATGAACCCCCCATTTCACTTAGAAGGGATCTGGAACACTTAATGCTATTGATTGGTGAGCTATATAAAAAGAACCCTTTTAATTTAGAGCTTGCTCTGGAATATTGGTGTCCCTCAGAGCCTCTTCAGACGACCACTCTACTGGGTTCTTACCTTGGGGTGGCTCACCAGCGACCCCCTCAGCGCCAGGTTGTCTTGTCAAAGTTTGTTAGGCAAATGGGTGACCTGTTGCCTCCAACTATTTATATTCCTTATCTGAAAATGCTCCAGGGGTTGGCCAGCGGGCCCCAGTGTGCCCACTACTGTTTTAGCCTGCTCAAAGTCAACGGTGGCGGTCATGTTGAAAATATTCAGGGAGCAGGGGGCAGTCCTGTTTCCTGGGAACATTTCTTTCACTCCTTAATGCTTTACCATGAACACCTCCGGAAGGATCTTCCGAGTGCAGACAGTGTCCAGTACCGTCACCTTCCTTCGCGTGGCATCACCCAGAAGGAGCAGGATGGACTGATCGCTTTTTTACAGCTCACATCTACCATCATTACGTGGAGTGAAAATGCTCGTCTGGCACTCTGTGAACATCCTCAGTGGACCCCGGTTGTGGTGATTCTGGGACTCCTGCAGTGCAGTATCCCCCCTGTTCTAAAGGCCGAGCTGCTGAAGACACTGGCAGCTTTTGGAAAATCTCCTGAAATTGCTGCTTCCCTCTGGCAGTCATTGGAATACACCCAGATACTGCAGACTGTAAGGGTTCCAAGCCAGAGGCAAGCTATTGGTATTGAGGTCGAACTAAATGAAATAGAATCCCGGTGTGAAGAATACCCGTTGACTCGGGCCTTTTGCCAACTTATTAGTACCCTGGTGGAGAGCTCGTTTCCTTCTAATTTGGGTGCTGGACTGCGGCCCCCTGGCTTTGACCCTTATTTGCAGTTCCTCAGAGATTCTGTGTTTCTCCGATTCCGCACAAGAGCTTACCGGAGAGCAGCTGAAAAGTGGGAAGTTGCTGAAGTTGTTTTGGAAGTGTTTTATAAATTGCTTAGAGATTATGAGCCCCAACTTGAAGATTTTGTAGACCAGTTTGTGGAACTACAAGGAGAAGAAATCATAGCCTATAAGCCACCAGGATTTAGTCTGATGTATCATCTTCTGAATGAGTCACCAATGTTGGAGCTTGCTCTTAGCTTACTGGAAGAAGGCGTTAAGCAGCTGGATACTTATGCCCCTTTCCCTGGGAAGAAGCATTTGGAGAAAGCGGTACAGCACTGCCTTGCCCTTCTCAATCTTACTCTGCAAAAGGAAAACCTCTTTATGGATCTTCTAAGAGAGAGTCAACTGGCTCTGATAGTCTCTCCTTTAGAACAGCTTCTGCAGGGCATCAATCCCAGAACTAAGAAGGCTGATAATGTGGTGAATATTGCCAGATACCTGTATCATGGCAATACTAATCCAGAATTGGCTTTCGAAAGTGCCAAGATCCTCTGCTGTATCTCTTGCAACACCAATATTCAGATAAAATTGGTTGGAGATTTCACACATGACCAGAGTGTAAGTCAGAAGCTGATGGCTGGATTCGTGGAGTGTTTGGATAGTGAAGATACAGAAGAATTTGTACGTTTAGAAGAGGGATCAGAACTTGAAAAGAAATTAGCTGGCATCCGTCATGAAACAAGAATCCACATCTTGAATCTTCTCATCACCTCTTTGGAACGCAATCCACCCAGTCTTGCTCTCTACCTGTTAGGCTTTGAATTAAAGAAACCTGTCAGTACCACAAACCTACAAGATCCAGGAGTGTTAGGCTGCCCTCGAACGTGCCTTCACGCCATCTTAAACATCTTGGAGAAAGGAACGGAAGGGAGGACAGGCCCGGTGGCAGTGAGAGAATCGCCTCAACTCGCTGAGCTGTGTTACCAGGTGATATATCAGTTATGTGCATGCTCCGATACATCTGGCCCTACTATGAGGTACTTGAGAACCAGCCAGGATTTCTTATTTTCTCAATTGCAACATTTACCTTTTTCTAATAAAGAATATGAAATATCTATGTTGAACCAAATGTCATGGCTGATGAAGACTGCTTCGATAGAACTAAGGGTAACCTCTCTGAATCGTCAGCGGTCACATACCCAGCGGCTCCTGCACCTCTTGTTGGATGACATGCCAGTGAAACCATACTCAGGTGAACATGTGAATTGTTGGCATTTGTTTTATTGTGCTGCTGACGGATCTGGGTGAATTCAAG