Transcript asmbl_118765

Sequence
Transcript Sequence for observation asmbl_118765 of TGE0057622:
CACGTTCTCCAGGAACACCTTCAGAACACCACGAGTCTCCTCATAGATAAGGCCAGAAATTCGCTTGACACCGCCGCGACGAGCAAGGCGCCGGATAGCTGGCTTAGTGATGCCCTGGATGTTATCGCGCAAAACCTTGCGATGACGCTTAGCTCCTCCCTTACCCAAACCTTTTCCACCTTTACCACGGCCAGACATGACTAAGCAACTTCTAAAACCAACTTAAGAAACCTAAACGCCAAGGCAAAGCAACGCCCTTATATGCCGG