Transcript asmbl_22887

Sequence
Transcript Sequence for observation asmbl_22887 of TGE0004254:
GGGACCCGCTTAATGTGATGTTTTCTTGGTTGCCTCTTCCTTCTTCATCTGCAGGCTGCGGTTCCTGTAACGACAGACGATCAGCTGCCATCTGTCTTCTGGAGGTCACCCCTCTAGGGTCTCTGGGGAACAATGGGAGTCTTGGGCTTCCTCACACTGGAAGCGAACGGCCCCATGCTGACAGTGGCCCTGTCTGTGGTCCTCTTGGCTCTCCTGAAATGGTACTCTACGTCAGCCTTTTCAAGACTGGAGAAGTTGGGCATCAGACATCCCAAGCCTTGTCCTTTTATTGGAAACTTGACATTTTTCCGCCAGGGCTTCTGGGAAAGTCAGATGGAGCTCAGAAAGCTGTATGGACCTCTGTGTGGGTACTATCTTGGCCGTCGGATGTTTATCGTTATCTCCAAACCGGACATGATCAAGCAGGTGTTGGTCGAGAACTTCAGTAACTTTACCAACAGAATGGCATCGGGTTTGGAATCCAAACCGGTAGCAGACAGCGTGCTGTTTTTACGTGACAAAAGATGGGAAGAGGTCAGAAGTGTTCTAACTTCTGCTTTCAGTCCTGAGAAGCTGCATGAGATGATTCCTCTAATCAACCAAGCCTGCGACCTTCTCCTGACTCATTTAAAACACGATGCGGAACGTGGAGACGCTGTCGACATCCAGAGGTGCTACAGCTGCTACAGCACAGATGTGGTGGCCAGTGTCGCCTTCGGCACCCAGGTGGACTCCCGAAAGGCTCCTGAGGACCCCTTTGTCAAGTACTGCAGGCGTTTCTTTGCCTTCGGCATCCCCAGACCTCTCCTGGTTTTCATCGTATCATTTCCATCCATAATGGTCCCACTGGCCCGGATTTTGCCCAATAAGAACCGAGATGAACTGAATGGCTTTTTTAACAAACTCATTAGGAATGTGATTGCCTTGCGGGACCAGCAAGCAGCAGAAGAGAGGCGGAGAGACTTCCTCCAAATGGTCCTGGATGCCCGACAATCCACCCCTTCCGTGGGCGTGGAGAGCTTCGACATAGTCAGACAAGTCTTCTCATCCTCCGAATGCTCAGCGAATCCTTCCCAGCAAGGCCAGCCCAGACCCCTGTCCAAGCCCTTGACTGTGGATGAGATCGTGGGCCAGGCCTTCCTCTTCCTCATCGCCGGCTACGAGATCATCACCAACACACTATCTTTCGCCACCTACCTACTGGCCACCAACCCTGACTGCCAAGAGAAGCTTCTGACAGAGGTGGACCGTTTCAACGAGAAATATGCGACCCCCGAGCTCTGCAGCCTCCAGGAAGGCCTGCCCTACCTGGACATGGTGATCGCAGAGACCTTGAGGATGTACCCGCCAGCTTTCAGGTTCACGCGGGAGGCGGCAAAGGACTGCGAAGTGCTGGGGCAGCGCATCCCCGCCGGCACCGTGGTGGAGATGGCCGTGGGCGCCCTGCACCGCGACCCGGAGCACTGGCCCCGCCCCGAGGCCTTCGACCCGGAGAGGTTCACGGCGGAGGCCCAGCGGCGCCGGCGGCCCTTCACCTACCTGCCATTTGGAGCGGGGCCCCGGAGCTGCCTCGGCGTGAGGCTGGGGCTGCTGGAGGTCAAGCTGACGCTGCTCCACGTCTTCCGGAAGTTCCGGTTCAAAGTCTGCCCCGAGACTCAGGTGCCACTGCAGCTAGAATCCAAATCTGCCCTAGGTCCGAAAAATGGTGTCTACATCAAGATTGTCTCCCGCTGACAGTTAAGAGGGCACCCCCTAATTCGAGGAAAACTTTCATGTGGAAATTCAGATATTTGGGGAGACATCACCTTAGCCATTGAAAGGGTGTCTGGAATGCAAGTATACAAGAAGTCATTTACATAACATGTCCTAAATGCTTAATAAATGTTTGCTGCACTT