Transcript asmbl_10279

Sequence
Transcript Sequence for observation asmbl_10279 of TGE0057110:
CCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGCCCACCATATGCCACCACGGTCCCAGAGCACGCTTCGGTGCAGGCAGGGGAGACGGTGCAGCTCCAGTGCCTGGCTCACGGGACACCCCCACTCACCTTCCAGTGGAGCCGCGTGGGCAGCAGCCTTCCTGGGAGGGCGACCGCCAGGAACGAGCTGCTGCACTTTGAGCGTGCAGCCCCTGAGGACTCAGGCCGCTACCGCTGCCGGGTCACCAACAAGGTGGGCTCAGCCGAGGCCTTTGCCCAGCTGCTCGTCCAAGGCCCTCCCGGCTCTCTCCCTGCCACCTCCATCCCAGCAGGGTCCACGCCCACCGTGCAGGTCACGCCTCAGCTAGAGACCAAGAGCATTGGGGCCAGCGTTGAGTTCCACTGTGCTGTGCCCAGCGACCGGGGTACCCAGCTCCGTTGGTTCAAGGAAGGGGGTCAGCTGCCTCCGGGTCACAGCGTGCAGGATGGGGTGCTCCGAATCCAGAACTTGGACCAGAGCTGCCAAGGGACGTATATATGCCAGGCCCATGGACCTTGGGGGAAGGCCCAGGCCAGTGCCCAGCTGGTTATCCAAGCCCTGCCCTCGGTGCTCATCAACATCCGGACCTCTGTGCAGACCGTGGTGGTTGGCCACGCCGTGGAGTTCGAATGCCTGGCACTGGGTGACCCCAAGCCTCAGGTGACATGGAGCAAAGTTGGAGGGCACCTGCGGCCAGGCATTGTGCAGAGCGGAGGTGTCGTCAGGATCGCCCACGTAGAGCTGGCTGATGCGGGACAGTATCGCTGCACTGCCACCAACGCAGCTGGCACCACACAATCCCACGTCCTGCTGCTTGTGCAAGCCTTGCCCCAGATCTCAATGCCCCAAGAAGTCCGTGTGCCTGCTGGTTCTGCAGCTGTCTTCCCCTGCATAGCCTCAGGCTACCCCACTCCTGACATCAGCTGGAGCAAGCTGGATGGCAGCCTGCCACCTGACAGCCGCCTGGAGAACAACATGCTGATGCTGCCCTCAGTCCGACCCCAGGACGCAGGTACCTACGTCTGCACCGCCACTAACCGCCAGGGCAAGGTCAAAGCCTTTGCCCACCTGCAGGTGCCAGAGCGGGTGGTGCCCTACTTCACGCAGACCCCCTACTCCTTCCTACCGCTGCCCACCATCAAGGATGCCTACAGGAAGTTCGAGATCAAGATCACCTTCCGGCCCGACTCAGCCGATGGGATGCTGCTGTACAATGGGCAGAAGCGAGTCCCAGGGAGCCCCACCAACCTGGCCAACCGGCAGCCCGACTTCATCTCCTTCGGCCTCGTGGGGGGAAGGCCCGAGTTCCGGTTCGATGCAGGCTCAGGCATGGCCACCATCCGCCATCCCACACCACTGGCCCTGGGCCATTTCCACACCGTGACCCTGCTGCGCAGCCTCACCCAGGGCTCCCTGATTGTGGGTGACCTGGCCCCGGTCAATGGGACCTCCCAGGGCAAGTTCCAGGGCCTGGATCTGAACGAGGAACTCTACCTGGGTGGCTATCCTGACTATGGTGCCATCCCCAAGGCGGGGCTGAGCAGCGGCTTCATAGGCTGTGTCCGGGAGCTGCGCATCCAGGGCGAGGAGATCGTCTTCCATGACCTCAACCTCACGGCGCACGGCATCTCCCACTGCCCCACCTGTCGGGACCGGCCCTGCCAGAATGGCGGTCAGTGCCATGACTCTGAGAGCAGCAGCTACGTGTGCGTCTGCCCAGCTGGCTTCACCGGGAGCCGCTGTGAGCACTCGCAGGCCCTGCACTGCCATCCAGAGGCCTGTGGGCCCGACGCCACCTGTGTGAACCGGCCTGACGGTCGAGGCTACACCTGCCGCTGCCACCTGGGCCGCTCGGGGTTGCGGTGTGAGGAAGGTGTGACAGTGACCACCCCCTCGCTGTCGGGTGCTGGCTCCTACCTGGCACTGCCCGCCCTCACCAACACACACCACGAGCTACGCCTGGACGTGGAGTTCAAGCCACTCGCCCCTGACGGGGTCCTGCTGTTCAGCGGGGGGAAGAGCGGGCCTGTGGAGGACTTCGTGTCCCTGGCGATGGTGGGCGGCCACCTGGAGTTCCGCTATGAGTTGGGGTCAGGGCTGGCCGTTCTGCGGAGCGCCGAGCCGCTGGCCCTGGGCCGCTGGCACCGTGTGTCTGCAGAGCGTCTCAACAAGGACGGCAGCCTGCGGGTGAATGGTGGACGCCCTGTGCTGCGCTCCTCGCCCGGCAAGAGCCAGGGCCTCAACCTGCACACCCTGCTCTACCTGGGGGGTGTGGAGCCTTCCGTGCCACTGTCCCCGGCCACCAACATGAGCGCTCACTTCCGCGGCTGTGTGGGCGAGGTGTCAGTGAATGGCAAACGGCTGGACCTCACCTACAGTTTCCTAGGCAGCCAGGGCATCGGGCAATGCTATGATAGCTCCCCATGTGAGCGCCAGCCTTGCCAACATGGTGCCACGTGCATGCCCGCTGGCGAGTATGAGTTCCAGTGCCTGTGTCGAGATGGATTCAAAGGAGACCTGTGTGAGCACGAGGAGAACCCCTGCCAGCTCCGTGAACCCTGTCTGCATGGGGGCACCTGCCAGGGCACCCGCTGCCTCTGCCTCCCTGGCTTCTCTGGCCCACGCTGCCAACAAGGCTCTGGACATGGCATAGCAGAGTCCGACTGGCATCTTGAAGGCAGCGGGGGCAATGATGCCCCTGGGCAGTACGGAGCCTATTTCCACGATGATGGCTTCCTCGCCTTCCCTGGCCATGTCTTCTCCAGGAGCCTGCCCGAGGTGCCCGAGACCATCGAGCTGGAGGTTCGGACCAGCACAGCCAGTGGCCTCCTGCTCTGGCAGGGTGTGGAGGTGGGAGAGGCCGGCCAAGGCAAGGACTTCATCAGCCTCGGGCTTCAAGACGGGCACCTTGTCTTCAGGTACCAGCTGGGTAGTGGGGAGGCCCGCCTGGTCTCTGAGGACCCCATCAATGACGGCGAGTGGCACCGGGTGACAGCACTGCGGGAGGGCCGCAGAGGTTCCATCCAAGTCGACGGTGAGGAGCTGGTCAGCGGCCGGTCCCCAGGTCCCAACGTGGCAGTCAACGCCAAGGGCAGCGTCTACATCGGCGGAGCCCCTGACGTGGCCACGCTGACCGGGGGCAGATTCTCCTCAGGCATCACAGGCTGTGTCAAGAACCTGGTGCTGCACTCGGCCCGACCCGGCGCCCCGCCCCCACAGCCCCTGGACCTGCAGCACCGCGCCCAGGCCGGGGCCAACACACGCCCCTGCCCCTCGTAGGCACCTGCCTGCCCCACACGGACTCCCGGGCCACGCCCCAGCCCGACAATGTCGAGTATATTATTATTAATATTATTATGAATTTTTGTAAGAAACCGAGGCGATGCCACGCTTTGCTGCTACCGCCCTGGGCTGGACTGGAGGTGGGCATGCCACCCTCACACACACAGCTGGGCAAAGCCACAAGGCTGGCCAGCAAGGCAGGTTGGATGGGAGTGGGCACCTCAGAAAGTCACCAGGACTTGGGGTCAGGAACAGTGGCTGGGTGGGCCCAGAACTGCCCCCACTGTCCCCCTACCCACCGATGGAGCCCCCAGATAGAGCTGGGTGGCCTGTTTCTGCAGCCCTTGGGCAGTTCTCACTCCTAGGAGAGCCAACCTCGGCTTGTGGGCTGGTGCCCCACAGCTACCTGAGACGGGCATCGCAGGAGTCTCTGCCACCCACTCAGGATTGGGAATTGTCTTTAGTGCCGGCTGTGGAGCAAAAGGCAGCTCACCCCTGGGCAGGCGGTCCCCATCCCCACCAGCTCGTTTTTCAGCACCCCCACCCACCTCCACCCAGCCCCTGGCACCTCCTCTGGCAGACTCCCCCTCCTACCACGTCCTCCTGGCCTGCATTCCCACCCCCTCCTGCCAGCACACAGCCTGGGGTCCCTCCCTCAGGGGCTGTAAGGGAAGGCCCACCCCAACTCTTACCAGGAGCTGCTACAGGCAGAGCCCAGCACTGATAGGGCCCCGCCCACCGGGCCCCGCCCACCCCAGGCCACATCCCCACCCATCTGGAAGTGAAGGCCCAGGGACTCCTCCAACAGACAACGGACGGACGGATGCCGCTGGTGCTCAGGAAGAGCTAGTGCCTTAGGTGGGGGAAGGCAGGACTCACGACTGAGAGAGAGAGGAGGGGGATATGACCACCCTGCCCCATCTGCAGGAGCCTGAAGATCCAGCTCAAGTGCCATCCTGCCAGTGGCCCCCAGACTGTGGGGTTGGGACGCCTGGCCTCTGTGTCCTAGAAGGGACCCTCCTGTGGTCTTTGTCTTGATTTTTCTTAATAAACGGTGCTATCCCCGCCAGGGGCCTCCTGAGTCTTTGATGAGGGCTTCACTCAGTGGAGCCTGTGGATGGGGCAGAGCAGGGCAGGTGAGATCTGGGGGTGAAGCAAGCTGGCTTGGGATCAGCGAGGCCCCCAGGCCCCCAACCCTGTGAGGCAGGAATTGTCCTATTTTCTAGAGGGGCAGCTGAGTCTCAGAGGGTTAGGGGGCCTGTCCAACATCAGACAGAGAGCCAGGGGGTTAGAACCCAAAGAGTCTGACCCCAGAGCCTAGTATCATTCCCATGTGCCCGAAGCCCCTCTAGGGATGGCCTCCCTGATCCTATAAGGCTGGGCCACTCAACTGCAGCCCCCTGGGGAGACCTGGCTGGGACATGGGTAGCACGTGGTACAGGCTGTGCTGCAGTGGAGGCAGAGGCCACGGGCACCAGGTTGCCAGGCCAGCCAGCTGGGAGAGCAACAGCACCAGAGGAGGCCCAGGAGGAGGCCAGCAGAGGCCAGGAGCATCGAGGAGGCCAGCGCCACCCCTCAGAGCTGGGGGCCTGTGGGAAGAGAAAGTCCACTCAGGCCTCGGCCTGGGTCCTCTGCCCCGTCCCCATCACCTAGAGAGGGACAGGTATGATTTTGGTGGGAAGAGTAGGAGCAAGGTGTAACCTTCCAAAGCTGCGTCTTGTCTCGTGGGGTCCCTGCCTGCTGGGGAACTCCTCTCAGCTGCAATCCAGAGGGATCCTGCAGACCCGAGAGCTGGGGAGGGAGTCAGGGATCTGGAGGTATGGGCATCTGTACTTCCTGTCTGGCTGGGCACCGGAGAGGGACCTGCATGGGAAAGAACAGAACTAGCACACTGAGAACTGCCCTTTCTGGGACACTTGTGTGTTTCATTCAATCCTCACAAGACTTCCCTGAGTTTGTCACTCTGTGTTTCCATTTTACAGAGAGGTTGTCACTTGCCGAGTTCAATTAGCTGGAAGTGATAGGAGGACTTGAACTCACATGGTCTGGCTCCAGGGCCTAAGGTCTATGAGTGGAGCTACTTCCCAAGGAAGAGGGTGTACATGTACTGAGCATTGAGGCAGGGTCTCACTCTGTCGCCCAGGCTGGAGT