Transcript asmbl_72256

Sequence
Transcript Sequence for observation asmbl_72256 of TGE0057065:
AGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGTTAGCTTTGTACATAGCATCTCACTTTGCACAACAACCCTGCAAGGCTGACCAACTGACTGAAGAGCAGATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAAGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTAGATGCTGATGGTAATGGCACAATTGACTTCCCTGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGATAAGGATGGCAATGGCTATATTAGTGCTGCAGAACTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAAGTTGATGAAATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACCTTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTCTTTGTTTGTAACTTATCTGTAAAAGGTTTCTCCCTACTGTCAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTATCTTACTGTCATTGTCCTAAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGATGGAGTTGGTCAAATGAGGGAACATCTGGGTTATGCCTTTTTTAAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCAACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTGCTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAATCTGCTTATGGCACAATTTGCCTCAAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAATTACAATTTACCCAATGGTTGCTCTGCATCTGAGTCATTTAACTGTTGAAGTCTAATAATTTTGAAAATAAAATATGGCATTGGTTTCTGCTTGGTA