Transcript asmbl_62740

Sequence
Transcript Sequence for observation asmbl_62740 of TGE0006294:
AGTGTCGGCGCCGCCACTGTCCGGCCACAGCCTAACGCTCTTCGCTGTCGTTTGTGGTCTCGCGCAGGGCGGCCCCGGTTCTGGTGTTTGGCGTCGGAATTAAACAACCACCATGTCGAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCCATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGCTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCCACTGATGCATACCTTGATGCCATGATGAATGAGGCCCCAGGGCCCATCAATTTCACCATGTTCCTGACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAACGCCTTTGCTTGCTTTGATGAAGAAGCAACAGGCACCATTCAGGAAGATTACCTAAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAAGAACTTTAGCTAAAATCTTCCAGTTACATTGTCTTACTCTCTTTTACTTCTCAGACACTTCCCCCACCCTCATAGAACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTCTTTTTGATGTATTTATTCCAGACCTTTCTGCCACTTAGCACTTGTATAATCAGACTGGAAATGGGGATGAGGGTGTAAATTGTATTGAAAAAGATCGCGAATAAAAATCAACAAATGTGAAAGCCCAGAAAAATATATTCGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGTTATTTTGAAATAAAGATTATGCTGACTCAAATGCAATGTAATGGCAAGTTAAACAAATGATTGATAGGTGGGGGTAGTCCTTTTTTCAGGTTTTCAACTTCATATGATTCAGGTTTTATGGTAAAATTGATTTTTCACATATATGGGACAGTGTTCTTCAGAACTTTTAAGTACCCTTTAACATTATTATGCAGTAAAAACTAGTTATGCCATTGTTTTTCACGCTTCTAGTCAGATGTTTATTAAATGATAAATATAGAATGTATCTGGGAAAACATTAAACATTGCGTTCATCTAAGATTCTGAGAAGAGGCAAAATTCCGAAGATTAGTTATTGTACATTTACTATATGTGGAGC