Transcript asmbl_59485

Sequence
Transcript Sequence for observation asmbl_59485 of TGE0058317:
CAGGGCTAGAGGTTGCCCACACCCAGGGAACCCAGGAACTAACCTCACAAGCTCTGAGGCTCAGAGGAGGCCCCTCCTCTTCCTGCTCCAACCATCCGGGCCAAGAGGCCTCCCAGTCAGACCTGGACGGCTCCAGCCGTGTCCTGAGGAGCTGGACCAGCCACATCCCCTGGGGCTGCAGTTGAAGCAGAACCAAGTGGCCATCCCGGCGTTAGACCGTAGGTTCCTGGTCCCGGAGTGGTCGGAGCCCGCCAGTGGGCAGGCAGCTCTTGCTCACAGGCCGCGGTGCCCAGGCCGCTGGCTCTCCGCAGGGCGGAATGGCGCTGCAAGTGGAGCTGGTACCCACCGGGGAGATCATCCGCGTGGTTCATCCCCACAGGCCCTGCAAGCTTGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTTCATCGAGCTCACGCTCAAGTCGGAGCAGGAGGAGTACGAGGCAGAGGGCATCGCGTGGGAGCCCGTCCAGTATTTCAACAACAAAATCATCTGTGATCTGGTGGAGGAGAAGTTTAAGGGCATCATCTCGATTTTGGATGAGGAGTGTCTGCGCCCCGGGGAGGCCACAGACCTGACCTTCCTGGAGAAGCTGGAGGATACTGTCAAGCACCATCCACACTTCCTGACGCACAAGCTGGCTGACCAGCGGACCAGGAAATCTCTGGGCCGAGGGGAATTCCGCCTTCTGCACTATGCGGGGGAGGTGACCTACAGCGTGACCGGGTTTCTGGACAAAAACAATGACCTTCTCTTCCGGAACCTTAAGGAGACCATGTGTAGCTCAAAGAATCCCATTATGAGCCAGTGCTTTGACCGGAGCGAGCTCAGTGACAAGAAGCGGCCAGAGACGGTCGCCACCCAGTTCAAGATGAGCCTCCTGCAGCTGGTGGAGATCCTGCAGTCTAAGGAGCCCGCCTACGTCCGCTGCATCAAACCCAATGATGCCAAACAGCCCGGCCGCTTTGACGAGGTGCTGATCCGCCACCAGGTGAAGTACCTGGGGCTGTTGGAAAACCTGCGCGTGCGCAGAGCCGGCTTTGCCTATCGCCGCAAATACGAAGCTTTCCTGCAAAGGTACAAGTCACTGTGCCCAGAGACGTGGCCCACGTGGGCAGGACGGCCGCAGGATGGGGTGGCTGTGCTGGTCCGACACCTGGGCTACAAGCCAGAAGAGTACAAGATGGGCAGGACCAAGATCTTCATCCGCTTCCCCAAGACCCTGTTTGCCACAGAGGATGCCCTGGAGGTCCGGCGGCAGAGCCTGGCCACAAAGATCCAAGCTGCCTGGAGGGGCTTTCACTGGCGGCAGAAATTCCTCCGGGTGAAGAGATCAGCCATCTGCATCCAGTCGTGGTGGCGTGGAACACTGGGCCGGAGGAAGGCAGCCAAGAGGAAGTGGGCGGCACAGACCATCCGGCGGCTCATCCGAGGCTTCGTCCTGCGCCACGCCCCCCGCTGCCCCGAGAACGCCTTCTTCCTGGACCATGTGCGCACCTCTTTTTTGCTAAACCTGAGGCGGCAGCTGCCCCAGAATGTCCTGGACACCTCGTGGCCCACGCCCCCACCTGCCCTGCGTGAGGCCTCAGAGCTTCTGCGGGAGTTGTGCATAAAGAACATGGTGTGGAAATACTGCCGGAGTATCAGCCCTGAGTGGAAGCAGCAGCTGCAGCAGAAGGCCGTGGCTAGTGAGATCTTCAAGGGCAAGAAGGATAATTACCCTCAGAGTGTACCCAGGCTCTTCATCAGCACTCGGCTTGGTACAGATGAGATCAGCCCCCGAGTGCTGCAGGCCTTGGGCTCTGAGCCCATTCAGTATGCGGTGCCTGTTGTGAAATACGACCGCAAGGGCTACAAGCCTCGCTCCCGGCAGCTGCTGCTCACGCCCAACGCCGTCGTCATCGTGGAGGACGCCAAAGTCAAGCAGAGGATTGATTACGCCAACCTGACCGGAATCTCTGTCAGCAGCCTGAGCGACAGTCTTTTTGTGCTTCATGTACAGCGTGCGGACAATAAGCAAAAGGGAGATGTGGTGCTGCAGAGTGACCACGTGATTGAGACGCTGACCAAGACAGCCCTCAGTGCCAACCGCGTGAACAGCATCAACATCAACCAGGGCAGCATCACGTTTGCAGGGGGCCCCGGCAGGGATGGCACCATTGACTTCACACCCGGCTCGGAGCTGCTCATCACCAAGGCCAAGAACGGGCACCTGGCTGTGGTCGCCCCACGGCTGAATTCTCGGTGATAAAGGCGCCCACTGGACCCTCCCAACGCCCAATGCTTTGCTTTTCTCCTCCTCCCCTTCCCAGTTACCAAAGACTCGAACTTCCAGACAGGGACCCAGGGACACCCCGAAGCCCACCTGCAATCTCCCACCTCCTGCCCATCCCTCTCTTGAGGGAGCAGCAGGGGCCAGGAGCTACCCCAGGAGTGGGCCAGGCCGGGCCACAGCAATAGGAAAGCCAGGGCCAGAGCGAGCCATGCCAGCCCTACTGCCGATGCCAAATATTTGAGAGAAGGGAACTTTTGCTGAGGTTTTCTCTGAGGTTTTTTTGATGCTTTATAGGAAACTATTTTTTAAAAAAAGCCATTTCCCACCCAAGGACACAGTGGATGTGTTTTCCCTGACTCCAGCAGGGCAAGGAATGTAGCCGAGAGGTTGTGTGGGCTGGGCTCTGGTGCCCTCTTCCCTGGCCAGGACACCTCTCCTCCTGATTCCCTTGGCACCTTGTCTTTCTGTCTGTTTACCTGTCTCCCTGCCTGCCCATCTGCATCTTTTGCAGCCCACTCTGACTTCCATCTGGGGGCTGAGACCACCCTTGCCTGCCCCCTTCTTTCTGCCTTAAGAATGTCCTTTTAGGCTGGGCATGGTGGCTCACGCCTGTAACCCCA