Transcript asmbl_53197

Sequence
Transcript Sequence for observation asmbl_53197 of TGE0000661:
CGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATCCGTCTGCCATCGGCGCCATCCTGCAATCTAAGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTCTCAAGAGTATCAACAATGCCGAAAAGAGAGGCAAACGCCAGGTGCTTATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTCACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATTGATGACCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGCTAAACAAGTGTGGGGTGATCAGCCCCAGATTTGACGTGCAACTCAAAGACCTGGAAAAATGGCAGAATAATCTGCTTCCATCCCGCCAGTTTGGTTTCATTGTACTGACAACCTCAGCTGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATATATTTACAAATAAAATGCCTCATGGACTCTGGTGCTTCCACTTGGTCGTTTTGAGCCTTTACAGCAGTGTAGCCACAGCTTCTGCGGCAGCATGCAGTTGCTTCGTTTATCGGTGAATGCGATTCCCTGAAGTGACTAATACAGCCAAGGGAAAAAGTTCTTATGAAACCAGTATGCCTAAGAAACAGTCACCCCTGCTGTCTGCCAAAACCAGGTATTTGACACT