Transcript asmbl_44797

Sequence
Transcript Sequence for observation asmbl_44797 of TGE0056538:
TTTTTCTTTCTTTTTTTAAAAAAAGTATTTCTCTCGCGAGAAACCGCTGCGCGGACGATACTTGAAGAGGTGGGGAAAGGAGGGGGCTGCGGGAGCCGCGGCAGAGACTGTGGGTGCCACAAGCGGACAGGAGCCACAGCTGGGACAGCTGCGAGCGGAGCCGAGCAGTGGCTGTAGCGGCCACGACTGGGAGCAGCCGCCGCCGCCTCCTCGGGAGTCGGAGCCGCCGCTTCTCCACTGGCAGGGGCCGCCTGAAGTGGGAGCAGCGCCTGGAGAAGGCGGGAGGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGGCGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAAACGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTACAGAATGGCCGGATCTGCAATAATGGACGCTGCATCAACACAGATGGCAGTTTTCATTGCGTGTGTAATGCGGGCTTTCATGTTACACGAGATGGGAAGAACTGTGAAGATATGGATGAATGCAGCATAAGGAACATGTGCCTTAATGGAATGTGTATCAATGAAGATGGCAGTTTTAAATGTATTTGCAAACCTGGATTCCAGCTGGCATCAGATGGACGTTATTGCAAAGACATTAACGAGTGTGAAACCCCTGGGATCTGCATGAATGGGCGTTGCGTCAACACTGATGGCTCCTACAGATGTGAATGCTTCCCTGGACTGGCTGTGGGTCTGGATGGCCGTGTGTGTGTTGACACACACATGCGGAGCACATGCTATGGTGGATACAAGAGAGGCCAGTGTATCAAACCTTTGTTTGGTGCTGTCACTAAATCTGAATGCTGTTGCGCCAGCACTGAGTATGCATTTGGGGAACCTTGCCAGCCGTGTCCTGCACAGAATTCAGCGGAATATCAGGCACTCTGCAGCAGTGGGCCAGGAATGACGTCAGCAGGCAGTGATATAAATGAATGTGCACTAGATCCTGATATTTGCCCAAATGGAATCTGTGAAAACCTTCGTGGGACCTATAAATGTATATGCAATTCAGGATATGAAGTGGATTCAACTGGGAAAAACTGCGTTGATATTAATGAATGTGTACTGAACAGTCTCCTTTGTGACAATGGACAATGTAGAAATACTCCTGGAAGTTTTGTCTGTACCTGCCCCAAGGGATTTATCTACAAACCTGATCTAAAAACATGTGAAGACATTGATGAATGCGAATCAAGTCCTTGCATTAATGGAGTCTGCAAGAACAGCCCAGGCTCTTTTATTTGTGAATGTTCTTCTGAAAGTACTTTGGATCCAACAAAAACCATCTGCATAGAAACCATCAAGGGCACTTGCTGGCAGACTGTCATTGATGGGCGATGTGAGATCAACATCAATGGAGCCACCTTAAAGTCCCAGTGCTGCTCCTCCCTCGGTGCTGCGTGGGGAAGCCCGTGCACCCTATGCCAAGTTGATCCCATATGTGGTAAAGGGTACTCAAGAATTAAAGGAACACAATGTGAAGATATAGATGAATGTGAAGTGTTCCCAGGAGTGTGTAAAAATGGCCTGTGTGTTAACACTAGGGGGTCATTCAAGTGTCAGTGTCCCAGTGGAATGACTTTGGATGCCACAGGAAGGATCTGTCTTGATATCCGCCTGGAAACCTGCTTCCTGAGGTACGAGGACGAGGAGTGCACCCTGCCTATTGCTGGCCGCCACCGCATGGACGCCTGCTGCTGCTCCGTCGGGGCAGCCTGGGGTACTGAGGAATGCGAGGAGTGTCCCATGAGAAATACTCCTGAGTACGAGGAGCTGTGTCCGAGAGGACCCGGATTTGCCACAAAAGAAATTACAAATGGAAAGCCTTTCTTCAAAGATATCAATGAGTGCAAGATGATACCCAGCCTCTGCACCCACGGCAAGTGCAGAAACACCATTGGCAGCTTTAAGTGCAGGTGTGACAGCGGCTTTGCTCTTGATTCTGAAGAAAGGAACTGCACAGACATTGACGAATGCCGCATATCTCCTGACCTCTGTGGCAGAGGCCAGTGTGTGAACACCCCTGGGGACTTTGAATGCAAGTGTGACGAAGGCTATGAAAGTGGATTCATGATGATGAAGAACTGCATGGATATTGATGAGTGTCAGAGAGATCCTCTCCTATGCCGAGGTGGTGTTTGCCATAACACAGAGGGAAGTTACCGCTGTGAATGCCCGCCTGGCCATCAGCTGTCCCCCAACATCTCCGCGTGTATCGACATCAATGAATGTGAGCTGAGTGCACACCTGTGCCCCAATGGCCGTTGCGTGAACCTCATAGGGAAGTATCAGTGTGCCTGCAACCCTGGCTACCATTCAACTCCCGATAGGCTATTTTGTGTTGACATTGATGAATGCAGCATAATGAATGGTGGTTGTGAAACCTTCTGCACAAACTCTGAAGGCAGCTATGAATGTAGCTGTCAGCCGGGATTTGCACTAATGCCTGACCAGAGATCATGCACCGACATCGATGAGTGTGAAGATAATCCCAATATCTGTGATGGTGGTCAGTGCACAAATATCCCTGGAGAGTACAGGTGCTTGTGTTATGATGGATTCATGGCATCTGAAGACATGAAGACTTGTGTAGATGTCAATGAGTGTGACCTGAATCCAAATATCTGCCTAAGTGGGACCTGTGAAAACACGAAAGGCTCATTTATCTGCCACTGTGATATGGGCTACTCCGGCAAAAAAGGAAAAACTGGCTGTACAGACATCAATGAATGTGAAATTGGAGCACACAACTGTGGCAAACATGCTGTATGTACCAATACAGCAGGAAGCTTCAAATGTAGCTGCAGTCCCGGGTGGATTGGAGATGGCATTAAGTGCACTGATCTGGACGAATGTTCCAATGGAACCCATATGTGCAGCCAGCATGCAGACTGCAAGAATACCATGGGATCTTACCGCTGTCTGTGCAAGGAAGGATACACAGGTGATGGCTTCACTTGTACAGACCTTGATGAGTGCTCTGAGAACCTGAATCTCTGTGGCAATGGCCAGTGCCTCAATGCACCAGGAGGATACCGCTGTGAATGCGACATGGGCTTCGTGCCCAGTGCTGACGGGAAAGCCTGTGAAGATATTGATGAGTGCTCCCTTCCGAACATCTGTGTCTTTGGAACTTGCCACAACCTCCCTGGCCTGTTCCGCTGTGAGTGTGAGATAGGCTACGAACTGGACAGAAGCGGCGGGAACTGCACAGATGTGAATGAATGCCTGGATCCAACCACGTGCATCAGTGGGAACTGTGTCAACACTCCAGGCAGCTATATCTGTGACTGCCCACCTGATTTTGAACTGAACCCAACTCGAGTTGGCTGTGTTGATACCCGCTCTGGAAATTGCTATTTGGATATTCGACCTCGAGGAGACAATGGAGATACAGCCTGCAGCAATGAAATTGGAGTTGGTGTTTCCAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCCTTGTGAGATGTGTCCTGCTGTGAACACATCCGAGTACAAAATTCTTTGTCCTGGAGGGGAAGGTTTCCGACCAAATCCTATCACCGTTATATTGGAAGATATTGATGAGTGCCAGGAGCTACCAGGGCTGTGCCAAGGAGGAAAATGTATCAACACCTTTGGGAGTTTCCAGTGCCGCTGTCCAACCGGCTACTACCTGAATGAAGATACACGAGTGTGTGATGATGTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCTTTGTCATCGACATTTATACCGGTTTACCCGTTGATATTGATGAGTGCCGGGAGATCCCAGGGGTCTGTGAAAATGGAGTGTGTATCAACATGGTTGGCAGCTTCCGATGTGAATGTCCAGTGGGATTCTTCTATAATGACAAGTTGTTGGTTTGTGAAGATATTGACGAGTGTCAGAACGGCCCAGTGTGCCAGCGCAACGCCGAATGCATCAACACTGCAGGCAGCTACCGCTGTGACTGTAAGCCCGGCTACCGCTTCACCTCCACAGGACAGTGCAATGATCGTAATGAATGTCAAGAAATCCCCAATATATGCAGTCATGGGCAGTGCATTGACACAGTTGGAAGCTTTTATTGCCTTTGCCACACTGGTTTTAAAACAAATGATGACCAAACCATGTGCTTGGACATAAATGAATGTGAAAGAGATGCCTGTGGGAATGGAACTTGCCGGAACACAATTGGTTCCTTCAACTGCCGCTGCAATCATGGTTTCATCCTTTCTCACAACAATGACTGTATAGATGTTGATGAATGTGCAAGTGGAAATGGGAATCTTTGCAGAAATGGCCAATGCATTAATACAGTGGGGTCTTTCCAGTGCCAGTGCAATGAAGGCTATGAGGTGGCTCCAGATGGGAGGACCTGTGTGGATATCAATGAATGTCTTCTAGAACCCAGAAAATGTGCACCAGGTACCTGTCAAAACTTGGATGGGTCCTACAGATGCATTTGCCCACCTGGATACAGTCTTCAAAATGAGAAGTGTGAAGATATTGATGAGTGTGTCGAAGAGCCAGAAATTTGTGCCCTGGGCACATGCAGTAACACTGAAGGCAGCTTCAAATGTCTGTGTCCAGAAGGGTTTTCCTTGTCCTCCAGTGGAAGAAGGTGCCAAGATTTGCGAATGAGCTACTGTTATGCGAAGTTTGAAGGAGGAAAGTGTTCATCACCCAAATCCAGAAATCACTCCAAGCAGGAATGCTGCTGTGCCTTGAAGGGAGAAGGCTGGGGAGACCCCTGCGAGCTCTGCCCCACGGAACCTGATGAGGCCTTCCGCCAGATATGTCCTTATGGAAGTGGGATCATCGTGGGACCTGATGATTCAGCAGTTGATATGGACGAATGCAAAGAACCCGATGTCTGTAAACATGGACAGTGCATCAATACAGATGGTTCCTATCGCTGCGAGTGTCCCTTTGGTTATATTCTAGCAGGGAATGAATGTGTAGATACTGATGAATGTTCTGTTGGCAATCCTTGTGGAAATGGAACCTGCAAGAATGTGATTGGAGGTTTTGAATGCACCTGCGAGGAGGGATTTGAGCCCGGTCCAATGATGACATGTGAAGATATAAATGAATGTGCCCAGAATCCTCTGCTCTGTGCCTTCCGATGTGTGAACACTTATGGGTCATATGAATGCAAATGTCCCGTGGGATATGTGCTCAGAGAAGACCGTAGGATGTGCAAAGATGAGGATGAGTGTGAAGAGGGAAAACATGACTGTACTGAAAAACAAATGGAATGCAAGAACCTCATTGGCACATATATGTGCATCTGTGGACCCGGGTATCAGCGGAGACCTGATGGAGAAGGCTGTGTAGATGAGAATGAATGTCAGACGAAGCCAGGGATCTGTGAGAATGGGCGCTGCCTCAACACCCGTGGGAGCTACACCTGTGAGTGTAATGATGGGTTTACCGCCAGCCCCAACCAGGACGAGTGCCTTGACAATCGGGAAGGGTACTGCTTCACAGAGGTGCTACAAAACATGTGTCAGATCGGCTCCAGCAACAGGAACCCCGTCACCAAATCGGAATGCTGCTGTGACGGAGGGAGAGGCTGGGGTCCCCACTGTGAGATCTGCCCTTTCCAGGGGACTGTGGCTTTCAAGAAACTCTGTCCCCATGGCCGAGGATTCATGACCAATGGAGCAGATATCGATGAATGCAAGGTTATTCACGATGTTTGCCGAAATGGGGAATGTGTCAATGACAGAGGATCATATCATTGCATTTGTAAAACTGGGTACACTCCAGATATAACTGGGACTTCCTGTGTAGATCTGAACGAGTGCAACCAGGCTCCCAAACCCTGCAATTTTATCTGCAAAAACACAGAAGGGAGTTACCAGTGTTCATGCCCGAAAGGCTACATTCTGCAAGAGGATGGAAGGAGCTGCAAAGATCTTGATGAGTGTGCAACCAAGCAACACAACTGCCAGTTCCTATGTGTTAACACCATTGGCGGCTTCACATGCAAATGTCCTCCCGGATTTACCCAACACCATACGTCCTGCATTGATAACAATGAATGCACCTCTGACATCAATCTGTGCGGGTCTAAGGGCATTTGCCAGAACACTCCTGGAAGCTTCACCTGTGAATGCCAGCGGGGATTCTCACTTGATCAGACCGGCTCCAGCTGTGAAGACGTGGACGAGTGTGAGGGTAACCACCGCTGCCAGCATGGCTGCCAGAACATCATTGGGGGCTACAGGTGCAGCTGCCCCCAGGGCTACCTCCAGCACTACCAGTGGAACCAGTGTGTTGATGAAAACGAATGCCTCAGCGCTCACATCTGCGGAGGAGCCTCCTGTCACAACACCCTGGGGAGCTACAAGTGCATGTGTCCCGCCGGCTTCCAGTATGAACAGTTCAGTGGAGGATGCCAAGACATCAATGAATGTGGCTCTGCGCAGGCCCCCTGCAGCTATGGCTGTTCCAATACCGAGGGCGGTTACCTGTGTGGCTGTCCACCTGGTTACTTCCGCATAGGCCAAGGGCACTGTGTTTCTGGAATGGGCATGGGCCGAGGAAACCCAGAGCCACCTGTCAGTGGTGAAATGGATGACAATTCACTCTCCCCAGAGGCTTGTTACGAGTGTAAGATCAATGGCTACCCCAAACGGGGCAGGAAACGGAGAAGCACAAACGAAACTGATGCCTCCAATATCGAGGATCAGTCTGAGACAGAAGCCAATGTGAGTCTTGCAAGTTGGGATGTTGAGAAGACAGCCATCTTTGCTTTCAATATTTCCCACGTCAGTAACAAGGTTCGAATCCTAGAACTCCTTCCAGCTCTTACAACTCTGACGAATCACAACAGATACTTGATCGAATCTGGAAATGAAGATGGCTTCTTTAAAATCAACCAAAAGGAAGGGATCAGCTACCTCCACTTCACAAAGAAGAAGCCAGTGGCTGGAACCTATTCATTACAAATCAGTAGTACTCCACTTTATAAAAAGAAAGAACTTAACCAACTAGAAGACAAATATGACAAAGACTACCTCAGTGGTGAACTGGGTGATAATCTGAAGATGAAAATCCAGGTTTTGCTTCATTAATTCACCATCCAGAGACCAAATAATTAAAAGAAAAACAAATATAGATAGGTAGAACTATATTTTCCCCCAATCAGAATCATCATATCATAGGTACAATCTTTCACCAAGTAAATTTGTATAAATAAGCACTATTCTTTGTATTACCAAAGCAAGGTACAGGTGACTACCCTAGTTCAAAACAACCACTTTCTCAGGCTTCTCATGTGTGTAGCTAAGCTACCTTGTCATATGTGTTGATTCTTGAAAACTGGGACGTGTATTTCCATTGGGGGTTGGCCATTTATGCTGACATGCCATCCTTCCAGCAAACGTACGGGAATGTGCTTTCAATTGATGGACTACTCTATTTTTTGCAAATTTGTAAACTTTGCTTCTCCAAATACAAGTACTAGGTTGTCCATTTATGGTACCTATTTGGTGCTAGTAAATTTTCAAACTAGATTTATAAATGCACTGTAATATGTACACAACTTAGAAACCAAATTACAAGTATTCAGTTCCAATACTTCATTAATTTCAATCAACCAAAGTTAGTTCAGTAGCTTATCTCAGTTATGAGTATAATACATTACATGTAAATTAAGTGTGTGTATACTGTAATCGTGCTATTTTTTATCATTGAAACATTTATAAACTAGAATAATAATGCCCTTAATGTGAGGGTTTGTAATGGTGCTTATTAAGACCAAAGACTTGTTAAATGTATACACCAAGTGGTAATGAAATTTCGGTGACTGGCCCACACGTGCATAGAGGTCTGGGAGGACCAGGAAACAGCCTCAGTGGCCAGAGGATCACCAGTGCATCCTTCATCACAGCATGTGCAATATGCCAAGATTACCCTCGGTCATTCCTGTCAACAAGGGGTCAATGTCATAAATGTCACAATAAAACAATCTCTTCTTTTTTTTAGTTTACCCCTTGGCTTTGTGTTCTTGCATGGATTTGGGGTTGGAGGGGCCATTCCGGAGGCTAAATAAAGTCTCCTGGATTTAAATTATCCTGGGTCTCTTACTTATGGCTTATGAAAGTACCAAATGTATAACCACTAGAAGAAAATTTAACATATGAGTCGATCCCTTGTTTTATCCATTGAAAGTAGCAGAGTCTGGTGTCATTAACCTGACTTGCTTGTGAGAAATTTAGATTGTAGAGTCATTTCTGAAACATGACCTAATTCATCTTGTGACTTTTAAATAGTCTTAAATACCAAGTTCAGTCATTGTCTTAGAGCACATGAATTTCATTATAATAGATTTATCATGCCCCCCTCTCAAATATACACAGTTTTGGCAAGCCTTAGGTGTTCTGTTCCATTTTTTTTTCCCCTAAACATCTTTCGTTAGTCAATGCTCATCTAATTACAAAGGGATAATCCCAGACTGTATCCAATTGCTGTAACTTTTGGTTTCTTAATGTCATAATTTTTAAAGTCTGTTTTATTTTAAGTGCAATATTGAGTATTTAGCTGTTAGGCTCAATCCGTCGATATGAAATAATTTTTTAAATCCCTAAGGGCAGGAAAGCATTTCGTGGTAGTGAAAATAAGAGGAAATAAGATGGCATGAAGGTGGTGGGCGGAGAAACTAGGTAGGACACAGGAAAGTGCTCTCAAAAATCTTTGAAGAGCTCAGCTGAAAAAAATGGAGTAGATTTGGCTCATACTATTCCGGAAGGCAAAACCAGGGTCAGCTGATGTCAGCCCCAGTTTAATACACACGGTCCCAATTATAGAGCTACTCACTGAAAGAATGGGTTTCCTTGCATTGTGGTGAGCTCCCTGTCACAAGATAGAAGAGTTTCAGTCTAGGCTTAATGGCAACCATTGGACAAAGATGCTTTCTTCCACCTAACAGGCCATTAACATCTTAAAGGTATTTTTGTATCTCTAATTTTGTTTATAATAGGTGCTCAACAGAATGAGCTGAATGGCTGTTACAAAGGGGGTTTGTACCTTGGGTAAGAGATTAAAATATAACTCAAAATTTCCTTCTAACGCTGCACCTATGGAACCATGTGATAGAGGTGTATTAAAATTGTTATCGAAGAATATATAGCATATGGTAAACAACAGTTTGCATATGGAAAATGTCTTTGATAATTTAACCAGAACTGCATTATATTCAATAACGGATTTTCTTTATAACAAACAACAGGGGAAAATGGAGTTGGCACACAGTGGATCACTTTGATATTTTTAATAGTCCAAGTCTGGATTTTATTTATTCCTGAGCCAACAATTTTGAACAGCATATTTTCCATGTTTCTGACTGTAACAAAACATTTTCCTCATTGTTCCATTGTAAATATTCCTCTTGTTGGAACTCTTTTTAATCCTGAGATTTAAACCTGTACCTTTCAATTGTCTGTGACCTTTCAATTTCACTTTCAATAGTTGAAGAACTTGGCTTTGTAAATCTCTCAGAAGCTTGAAAATATCTTGTCTCTACCCCCTCAGCCCATTTCATTTGCCAATAATTATTTTGTAAGTAGGGTTGAAATGAACTCAGCTGGCCTTGTGAAATGTTTAAACTTGCACAAACAACTACATTTTTGTTCAACAAATAGCAGTTTACTCAGCCAAAATCACTTTGGATATTGCCATTACAAATACTGTTAAACTTCAGAAATCATGTCTGTAAATTAGATGAGCCAAAATAAAGGACAATTGGGTTGA