Transcript asmbl_37329

Sequence
Transcript Sequence for observation asmbl_37329 of TGE0056198:
GCTCAGTGGCCCTGAGACCCTAGCTCTGCTCTCGGTCCGCTCGCTGTCCGCTAGCCCGCTGCGATGTTGCGCGCTGCCGCCCGCTTCGGGCCCCGCCTGGGCCGCCGCCTCTTGTCAGCCGCCGCCACCCAGGCCGTGCCTGCCCCCAACCAGCAGCCCGAGGTCTTCTGCAACCAGATTTTCATAAACAATGAATGGCACGATGCCGTCAGCAGGAAAACATTCCCCACCGTCAATCCGTCCACTGGAGAGGTCATCTGTCAGGTAGCTGAAGGGGACAAGGAAGATGTGGACAAGGCAGTGAAGGCCGCCCGGGCCGCCTTCCAGCTGGGCTCACCTTGGCGCCGCATGGACGCATCACACAGGGGCCGGCTGCTGAACCGCCTGGCCGATCTGATCGAGCGGGACCGGACCTACCTGGCGGCCTTGGAGACCCTGGACAATGGCAAGCCCTATGTCATCTCCTACCTGGTGGATTTGGACATGGTCCTCAAATGTCTCCGGTATTATGCCGGCTGGGCTGATAAGTACCACGGGAAAACCATCCCCATTGACGGAGACTTCTTCAGCTACACACGCCATGAACCTGTGGGGGTGTGCGGGCAGATCATTCCGTGGAATTTCCCGCTCCTGATGCAAGCATGGAAGCTGGGCCCAGCCTTGGCAACTGGAAACGTGGTTGTGATGAAGGTAGCTGAGCAGACACCCCTCACCGCCCTCTATGTGGCCAACCTGATCAAGGAGGCTGGCTTTCCCCCTGGTGTGGTCAACATTGTGCCTGGATTTGGCCCCACGGCTGGGGCCGCCATTGCCTCCCATGAGGATGTGGACAAAGTGGCATTCACAGGCTCCACTGAGATTGGCCGCGTAATCCAGGTTGCTGCTGGGAGCAGCAACCTCAAGAGAGTGACCTTGGAGCTGGGGGGGAAGAGCCCCAACATCATCATGTCAGATGCCGATATGGATTGGGCCGTGGAACAGGCCCACTTCGCCCTGTTCTTCAACCAGGGCCAGTGCTGCTGTGCCGGCTCCCGGACCTTCGTGCAGGAGGACATCTATGATGAGTTTGTGGAGCGGAGCGTTGCCCGGGCCAAGTCTCGGGTGGTCGGGAACCCCTTTGATAGCAAGACCGAGCAGGGGCCGCAGGTGGATGAAACTCAGTTTAAGAAGATCCTCGGCTACATCAACACGGGGAAGCAAGAGGGGGCGAAGCTGCTGTGTGGTGGGGGCATTGCTGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGACCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAGAGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAAAGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTCACAGTCAAAGTGCCTCAGAAGAACTCATAAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGAAAGTTCAGCAAGATCAGCAACAAAACCAAGAAAAATGATCCTTGCGTGCTGAATATCTGAAAAGAGAAATTTTTCCTACAAAATCTCTTGGGTCAAGAAAGTTCTAGAATTTGAATTGATAAACATGGTGGGTTGGCTGAGGGTAAGAGTATATGAGGAACCTTTTAAACGACAACAATACTGCTAGCTTTCAGGATGATTTTTAAAAAATAGATTCAAATGTGTTATCCTCTCTCTGAAACGCTTCCTATAACTCGAGTTTATAGGGGAAGAAAAAGCTATTGTTTACAATTATATCACCATTAAGGCAACTGCTACACCCTGCTTTGTATTCTGGGCTAAGATTCATTAAAAACTAGCTGCTCTTAACTTACTGGGTAACTCTTTGTCCATCTCAATAACCAAAGGAAGGTGGGCATGGTGGCTCACGCCTGTAATCCCA