Transcript asmbl_22841

Sequence
Transcript Sequence for observation asmbl_22841 of TGE0008558:
GGGAAGCCGGAGGAGCTCGGGAGGAAGCGAAGTAGCGAGCGGGAGGCGGCGGCGTCTCCCGTCGGCCTCCGGCAGCACTGACCGCGGGGAGGCCGGAAGGCGCGCGAGCTTGGCGGAGAGGCGGGCGGGAGGCCGGAGTTATTTAATGAAAAGTGCCATAGATTGAAAAATCGAAGATGAGGGTAGCAGGTGCTGCAAAGTTGGTGGTAGCTGTAGCAGTATTTTTACTGACATTTTATGTTATTTCTCAAGTATTCGAAATAAAAATGGATACGAGTTTAGGAAATCTATTTGCAAGGTCAGCATTGGACACAGCTGCTCGTTCTACAAAACCTCCCAGATACAAATGTGGGATCTCAAAAGCTTGCCCTGAAAAGCATTTTGCTTTTAAAATGGCAAGTGGAGCAGCCAACGTGGTGGGCCCCAAAATCTGCCTAGAAGACAATGTTTTAATGAGTGGTGTGAAGAATAATGTTGGAAGAGGGATCAATGTTGCCTTGGTAAATGGAAAGACAGGAGAAGTATTAGATACTAAATATTTTGACATGTGGGGAGGAGATGTGGCCCCATTTATTGAGTTTCTGAAGTCCATACAAGATGGGACAATAGTCTTAATGGGAACATATGATGATGGAGCAACCAAACTCAATGATGAGGCACGGCGGCTCATTGCTGAATTGGGGAGTACGTCCATTACCAGTCTTGGTTTTAGAGACAACTGGGTCTTCTGTGGTGGGAAAGGCATTAAGACAAAAAGCCCTTTTGAACAG