Transcript asmbl_37108

Sequence
Transcript Sequence for observation asmbl_37108 of TGE0000273:
CCAGATTCAGGCGTGTAAACCAGCCGGAGCGGCGCGGCAGCGGCAGGACCGCCGTGGCGCCTAGAGTAGCGACCCGGGGGGAGCGCGGGGCGACGCTGGCTGCAGGGACCCGGTGACAGCGTGAGAGGTACTAGGTTTTGACAAGCTTGCATCATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACTGTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGAACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTAGTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAACTGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCATGTCAGCTGCTTTAATATACTAAATGCATTGTAGCTCTGAGCCAGGTCTGAAGAACTGTTGCCCAATTCAACAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAATGGACTTTCCTGTGGTGGTACCCTTTAAGAGGCGGATGAAAGCTACTATATCAGTTTGCACATTCTAATCACTTTCCAGTATCACAAGAGAGATTTTTACTTATATAATAGTCCTAGAGTTTGCAGCTGGTAAAACCAGAGGCTACATCCAGTATTACTGCTAAGAGACATTCTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACATGCCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTCGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAGAAATTCAAGGTCATTATTATTGTACAAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTAAAAAACCTGTGGAGACGGTGATCTTGTCTTTAAAACATGATAGTCCTTTCAGTATAATGTCTTAGATTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCTTATTATATGTTTCCTTTTTTTGTTTACATAGGGAACAATGTTTATAGTCGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGAATCCCTTGCTTGCTCATGCATAAGTGTATTTGCAATACCAAATATACAGGTTTAGTATTTTTGCCTGTTAGTGATTGTTTCACATGTGTAACGTTTTGGTTGAGATGTTAAATGGTGGACGAGTACTGTGGATGTGAATGTGGGAAGTAATTTTAATCATATGTAATTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGCTTTGTATGCATTAATGTTTGGATGTAAAGATTGTGTGTCTATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTAATGTTACAACTACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATAACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAGGGCTTGCATTATAATTACTTGCCACTTGAATGTGTTTTGTGTAATGTTTTAACAGTGCTAGTAAATAAATACGGGTTTACCCTGGTTTTAATTGTAATAGGTGCATTTTACACAGCATGGTTTCATAATTTAACATCTGGGCAAGCCAGACTCATTAATTACAGGAATAAGGAAGTAGCGAGTTTTCTGGTATTGTTTGAATATCCACATAACCACCTTTTGAACTTTTCCTTGAGAAATAATTTTGTAAATCAAGCAGTATTACTTACGAATAAATGCCTTTGGGTAATGTTCAGTAGCTATTTGATGAGGTAGGTAAAAGAGGAACGATTTAACATACTTTCATGGATGTTACACTATGGATTTTTTAAAATACAGGATTGAAGTTAGAATATTGTGGTTATAAAAATCTTTGAGTGATGTGGATTAAGCACTTAGA