Transcript asmbl_22840

Sequence
Transcript Sequence for observation asmbl_22840 of TGE0008557:
CTTTAGTTTGCAAATAACGCATTATTTGTTGCCCAGATATGCCTTTTCCATGTTCCTCAGGTTGTGAATGTCAAAGGGGGCGTCTCCTTTCTCGATGCGGTTACTCCCATGGATTATTACCCCGGACTAAATTTGGAAGGCTACCCTAACAGAGACAGCACCAAATACGCTGAGGTTTATGGCATTCCCTCTGCTCACACGTTGTTGCGGGGTACACTGAGATATAAGGGATATGCCAAAGCCTTGAATGGGTTTGTGAAATTGGGTCTTATAAACAGAGATGCATTTCCTGCCCTTAGACCTGAAGCCAAGCCTCTCACCTGGAAAGAGCTCCTCTGTGATCTAGTTGGGATTTCACCCTCCTCCAAGTCCGATGTGCTCAAGGAAGCCGTCCTTAAGAAACTAGGAGGGGACAATACCCAGCTGGAGGCTGCTGTATGGTTGGGCTTGCTTGGGAATGATCAGGTCCCTCGGGCAGAGTCTGTTGTGGAAGCGCTCTCCAAGCATTTAGCCACAAAACTTTCGTACGGTCCCGGAGAGAAAGATATGATTGTGATGAGAGACAGCTTTGGAATCAGACATCCTTCTGGACATTTAGAAAGTAAAACTATTAATCTCGTGGTTTATGGAGACACCAAAGGCTTTTCAGCCATGGCTAAAACTGTGGGATTACCCACCGCGATGGCAGCCAAGATGTTGCTTGATGGTGAAATTCAAGCTAAAGGCCTGATTGGGCCCTTTTCAAAGGAGATCTATGGACCAATATTGGAGCGAATTAAAGCAGAAGGCATTATCTATACTACACAGAGCACAACCACACTTTAATTGAGAATTATTTTGTTTTTACCTTCTCAGGCAACACAGCTCTGAGCATTTGTGCAACAACCATGTTTGCTACTGTGCTGTTTTAAACTACAAAACATGATATGTTTTTGAATAAGTCATTACAGTGATGTTTTTGAAATATAAATGTCTATTTTAATATGAAAACATTTGAAACAGGAAATGCCAGTGATAGAGAACTTTAATAATTCTACTATGTATTTTTTCACATGTATGTAGAAGTGATAATGAGTTATTAATTTATTGTGCAACTTTTTTCCTACAAGAATATATTTTCCTATACTCAGCAGATGCAGTTTTATCTTTTTAGATATAAAAAAGTTTCCTC