Transcript asmbl_35671

Sequence
Transcript Sequence for observation asmbl_35671 of TGE0056499:
GCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGATTCCTTCAACACCTTCTTCAGTGAGACGGGGGCTGGCAAGCATGTGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACCATTGGCAAGGAGATCATTGACCTTGTGTTGGACCGAATTCGCAAGCTGGCTGACCAGTGCACCGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCCCTGCTCATGGAACGTCTCTCAGTTGATTATGGCAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCACCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGACATCTGTCGTAGAAACCTCGATATCGAGCGCCCAACCTACACTAACCTTAACCGCCTTATTAGCCAGATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCTCTGGCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAAACCAAGCGCAGCATCCAGTTTGTGGATTGGTGCCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTGGCCAAGGTACAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAAGATATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAGGAATACTAATTATCCATTCCTTTTGGCCCTGCAGCATGTCATGCTCCCAGAATTTCAGCTTCAGCTTAACTGACAGACGTTAAAGCTTTCTGGTTAGATTGTTTTCACTTGGTGATCATGTCTTTTCCATGTGTACCTGTAATATTTTTCCATCATATCTCAAAGTAAAGTCATTAACATCAAAAG