Transcript asmbl_30739

Sequence
Transcript Sequence for observation asmbl_30739 of TGE0058298:
CGAGCTGCTCACTTGGCTCTCGCCCTCCGGCCGGGAAGCATGGGGCTTCCCAGGCTGGTCTGCGCCTTCTTGCTCGCCGCCTGCTGCTGCTGTCCTCGCGTCGCGGGTGTGCCCGGAGAGGCTGAGCAGCCTGCGCCTGAGCTGGTGGAGGTGGAAGTGGGCAGCACAGCCCTTCTGAAGTGCGGCCTCTCCCAGTCCCAAGGCAACCTCAGCCATGTCGACTGGTTTTCTGTCCACAAGGAGAAGCGGACGCTCATCTTCCGTGTGCGCCAGGGCCAGGGCCAGAGCGAACCTGGGGAGTACGAGCAGCGGCTCAGCCTCCAGGACAGAGGGGCTACTCTGGCCCTGACTCAAGTCACCCCCCAAGACGAGCGCATCTTCTTGTGCCAGGGCAAGCGCCCTCGGTCCCAGGAGTACCGCATCCAGCTCCGCGTCTACAAAGCTCCGGAGGAGCCAAACATCCAGGTCAACCCCCTGGGCATCCCTGTGAACAGTAAGGAGCCTGAGGAGGTCGCTACCTGTGTAGGGAGGAACGGGTACCCCATTCCTCAAGTCATCTGGTACAAGAATGGCCGGCCTCTGAAGGAGGAGAAGAACCGGGTCCACATTCAGTCGTCCCAGACTGTGGAGTCGAGTGGTTTGTACACCTTGCAGAGTATTCTGAAGGCACAGCTGGTTAAAGAAGACAAAGATGCCCAGTTTTACTGTGAGCTCAACTACCGGCTGCCCAGTGGGAACCACATGAAGGAGTCCAGGGAAGTCACCGTCCCTGTTTTCTACCCGACAGAAAAAGTGTGGCTGGAAGTGGAGCCCGTGGGAATGCTGAAGGAAGGGGACCGCGTGGAAATCAGGTGTTTGGCTGATGGCAACCCTCCACCACACTTCAGCATCAGCAAGCAGAACCCCAGCACCAGGGAGGCAGAGGAAGAGACAACCAACGACAACGGGGTCCTGGTGCTGGAGCCTGCCCGGAAGGAACACAGTGGGCGCTATGAATGTCAGGGCCTGGACTTGGACACCATGATATCGCTGCTGAGTGAACCACAGGAACTACTGGTGAACTATGTGTCTGACGTCCGAGTGAGTCCCGCAGCCCCTGAGAGACAGGAAGGCAGCAGCCTCACCCTGACCTGTGAGGCAGAGAGTAGCCAGGACCTCGAGTTCCAGTGGCTGAGAGAAGAGACAGGCCAGGTGCTGGAAAGGGGGCCTGTGCTTCAGTTGCATGACCTGAAACGGGAGGCAGGAGGCGGCTATCGCTGCGTGGCGTCTGTGCCCAGCATACCCGGCCTGAACCGCACACAGCTGGTCAACGTGGCCATTTTTGGCCCCCCTTGGATGGCATTCAAGGAGAGGAAGGTGTGGGTGAAAGAGAATATGGTGTTGAATCTGTCTTGTGAAGCGTCAGGGCACCCCCGGCCCACCATCTCCTGGAACGTCAACGGCACGGCAAGTGAACAAGACCAAGATCCACAGCGAGTCCTGAGCACCCTGAATGTCCTCGTGACCCCGGAGCTGTTGGAGACAGGTGTTGAATGCACGGCCTCCAACGACCTGGGCAAAAACACCAGCATCCTCTTCCTGGAGCTGGTCAATTTAACCACCCTCACACCAGACTCCAACACAACCACTGGCCTCAGCACTTCCACTGCCAGTCCTCATACCAGAGCCAACAGCACCTCCACAGAGAGAAAGCTGCCGGAGCCGGAGAGCCGGGGCGTGGTCATCGTGGCTGTGATTGTGTGCATCCTGGTCCTGGCGGTGCTGGGCGCTGTCCTCTATTTCCTCTATAAGAAGGGCAAGCTGCCGTGCAGGCGCTCAGGGAAGCAGGAGATCACGCTACCCCCGTCTCGTAAGAGCGAACTTGTAGTTGAAGTTAAGTCAGATAAGCTCCCAGAAGAGATGGGCCTCCTGCAGGGCAGCAGCGGTGACAAGAGGGCTCCGGGAGACCAGGTAGGAGGCGGTTCCTGTGGCCAGAGCCTGCCACATCCTCAGGGACCGGGGGCAGTAGGGACTAACGGTTCTCTCTATCCTTCATCCCTCTTTGTCAGAGATAGGGAGCAGGCCCCATCTTGCCTTCTTAACACTACTCACAGATGGCAGGGCCAAGCAAGTGGCTGAGGGAGCTTGGAGGAAGACTGAGAAAGACCCTGTCCCATCACCTTTTCCTGACCAATGCCCGTGGCTCTGGGTGTGGCCATTTCACCAGTGCAGTCAGACGGGGGCCGCCCTCCTTCCCTGGCCTGCCATGCCCATCCTAGCTTCCTCCCCAACGCTGCCCACCAAATTCATCGGCTTCTGCTTCCATCTCTCCTTCCTCTCGGTGCTCACACCTTCAACTCAGCACCGTCTCCGTGTTCCCCTCTTCTCCTCTACCCACTTTTAGGGAGAGAAATACATCGATCTGAGGCATTAGCCCCGAATCACTTCAGCTCCCTTCCCTGCCTGGACCATTCCCAGCTCCCTGCTCACTCTTCTCTCAGCCAAAGCCTCCAAAGGGACTAGAGAGAAGCCTCCTGCTCCCCTCGCCTGCACACCCCCTTTCAGAGGGCCACTGGGTTAGGACCTGAGGACCTCACTTGGCCCTGCAAGGCCCGCTTTTCAGGGACCAGTCCACCACCATCTCCTCCACGTTGAGTGAAGCTCATCCCAAGCAAGGAGCCCCAGTCTCCCGAGCGGGTAGGAGAGTTTCTTGCAGAACGTGTTTTTTCTTTACACACATTATGGCTGTAAATACCTGGCTCCTGCCAGCAGCTGAGCTGGGTAGCCTCTCTGAGCTGGTTTCCTGCCCCAAAGGCTGGCTTCCACCATCCAGGTGCACCACTGAAGTGAGGACACACCGGAGCCAGGCGCCTGCTCATGTTGAAGTGCGCTGTTCACACCCGCTCCGGAGAGCACCCCAGCAGCATCCAGAAGCAGCTGCAGTGTTGCTGCCACCACCCTCCTGTCTGCCTCTTCAAAGTCTCCTGTGACATTTTTTCTTTGGTCAGAAGCCAGGAACTGGTGTCATTCCTTAAAAGATACGTGCCGGGGCCAGGTGTGGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGGC