Transcript asmbl_16005

Sequence
Transcript Sequence for observation asmbl_16005 of TGE0056753:
CCCACGTATGGCGCCTCTCCAAAGGCTGCAGAAGTTTCTTGCTAACAAAAAGTCCGCACATTCGAGCAAAGACAGGCTTTAGCGAGTTATTAAAAACTTAGGGGCGCTCTTGTCCCCCACAGGGCCCGACCGCACACAGCAAGGCGATGGCCCAGCTGTAAGTTGGTAGCACTGAGAACTAGCAGCGCGCGCGGAGCCCGCTGAGACTTGAATCAATCTGGTCTAACGGTTTCCCCTAAACCGCTAGGAGCCCTCAATCGGCGGGACAGCAGGGCGCGGTGAGTCACCGCCGGTGACTAAGCGACCCCACCCCTCTCCCTCGGGCTTTCCTCTGCCACCGCCGTCTCGCAACTCCCGCCGTCCGAAGCTGGACTGAGCCCGTTAGGTCCCTCGACAGAACCTCCCCTCCCCCCAACATCTCTCCGCCAAGGCAAGTCGATGGACAGAGGCGCGGGCCGGAGCAGCCCCCCTTTCCAAGCGGGCGGCGCGCGAGGCTGCGGCGAGGCCTGAGCCCTGCGTTCCTGCGCTGTGCGCGCCCCCACCCCGCGTTCCAATCTCAGGCGCTCTTTGTTTCTTTCTCCGCGACTTCAGATCTGAGGGATTCCTTACTCTTTCCTCTTCCCGCTCCTTTGCCCGCGGGTCTCCCCGCCTGACCGCAGCCCCGAGACCGCCGCGCACCTCCTCCCACGCCCCTTTGGCGTGGTGCCACCGGACCCCTCTGGTTCAGTCCCAGGCGGACCCCCCCCTCACCGCGCGACCCCGCCTTTTTCAGCACCCCAGGTCCTCTGCCACTCTCGCTCCGAGGTCCCCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACACCCACCGCGCCCTCGTTCGCCTCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCTCCGCAGCCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCACCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCCTGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGGGCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCGAGGACATCATGCGCCTCCGGGAGAAGTAAGGCTGCGCCCATGCAAGTAGCTGGGCCTCGGGAGGGGGCTGGAGGGAGAGGGGAACGCCCCCCCGGCCCCCGCGAGAGCTGCCACGCCCTTGGGGATGTGGCCGGGGGGAGGCCTGCCAGGGAGACAGCGGAGAGCGGGGCTGTGGCTGTGGTGGCGCAGCCCCGCCCAGAACCCAGACCTTGCAGTTCGCATTTCCTCCTCTGTCCCCACACATTGCCCAAGGACGCTCCGTTTCAAGTTACAGATTTCTTAAAACTACCACTTTGTGTGCAGTTGAAGGCCCTTGGGCACAATGAGAGCCAGTCCTCCAAACTTTCAGAAAGTTTCCTGCCCCTTCTGGCAGGCTGCCAATCACCGGGCGGGAGAAGGAAGGAGGGGAAGGCGGTGGAGGGAGCGAGACAAAGGGATGGTCCCTCGGGGGCGGGGATGGCGGGGCTGTCCTGTAGGTCTGTGCGGCCACCGTGATTGCCCCTCTGCGCGGTGCCCGAAGTCCCGCTGAAACCTGCCGAGGGCAGCAGGTCTGAAAGCTGCAGGCGCTAGTTGCGCGGAGGTGGCGCAGCTGCTCTGGAGGCGCAGAGCGAATACGTGGTGTTTGGGTGTGGCCGCCCCGCCCCTGGCGGTTTCCTCGTTCCCCTTTGGTTAATGCGCAACTGTTTCAGATTGCAGGAGGAGATGCTTCAGA