Transcript asmbl_134697

Sequence
Transcript Sequence for observation asmbl_134697 of TGE0056727:
ACCCGCTGCGGAGTGAACGGTGTGGAGCGGAGGCCGCGGAGGCTCCTCGGTCCTTCAGCACCCCTCGGCCCGACGCACCCACGCCCCTCACCCCCCGAGAGCCGAAAATGGACCCAAGTGGGGTCAAAGTGCTGGAAACAGCAGAGGACATCCAGGAGAGGCGGCAGCAGGTCCTAGACCGATACCACCGCTTCAAGGAACTCTCAACCCTTAGGCGTCAGAAGCTGGAAGATTCCTATCGATTCCAGTTCTTTCAAAGAGATGCTGAAGAGCTGGAGAAATGGATACAGGAAAAACTTCAGATTGCATCTGATGAGAATTATAAAGACCCAACCAACTTGCAGGGAAAGCTTCAGAAGCATCAAGCATTTGAAGCTGAAGTGCAGGCCAACTCAGGAGCCATTGTTAAGCTGGATGAAACTGGAAACCTGATGATCTCAGAAGGGCATTTTGCATCTGAAACCATACGGACCCGTTTGATGGAGCTGCACCGCCAGTGGGAATTACTTTTGGAGAAGATGCGAGAAAAAGGAATCAAACTGCTGCAGGCCCAGAAGTTGGTGCAGTACTTACGAGAATGTGAGGACGTGATGGACTGGATCAATGACAAGGAAGCAATTGTTACTTCTGAAGAGCTGGGCCAGGATCTGGAGCATGTAGAGGTTTTACAGAAGAAATTTGAAGAGTTTCAAACAGATATGGCTGCTCATGAAGAAAGAGTTAATGAAGTGAACCAGTTTGCTGCCAAACTCATACAGGAGCAGCACCCTGAGGAGGAACTGATCAAGACTAAGCAGGATGAAGTCAATGCAGCCTGGCAGCGGCTGAAGGGCCTGGCTCTGCAGAGGCAGGGGAAGCTCTTTGGGGCAGCAGAAGTTCAGCGCTTTAACAGGGATGTGGATGAGACTATCAGTTGGATTAAGGAAAAGGAGCAGTTAATGGCCTCTGATGATTTTGGCCGAGACCTGGCAAGTGTTCAGGCTCTGCTTCGGAAGCACGAGGGTCTGGAGAGAGATCTTGCTGCTCTAGAAGACAAGGTCAAAGCCCTGTGTGCTGAGGCTGACCGCCTGCAACAGTCCCACCCTCTGAGTGCAACACAGATTCAAGTGAAGCGAGAGGAACTGATTACAAACTGGGAGCAGATCCGCACCTTGGCGGCAGAGAGACATGCACGGCTCAATGATTCATACAGGCTTCAACGCTTCCTTGCTGACTTCCGTGACCTCACCAGCTGGGTGACTGAGATGAAAGCCCTCATCAATGCAGATGAGCTTGCCAGTGATGTGGCTGGGGCTGAAGCCCTGCTAGATAGACACCAAGAGCACAAGGGTGAAATTGATGCCCATGAAGACAGCTTCAAATCTGCAGATGAATCTGGACAGGCACTGCTTGCTGCTGGTCACTATGCCTCAGATGAAGTGAGGGAGAAGCTGACCGTCCTTTCCGAGGAGAGAGCGGCGCTGCTGGAGCTGTGGGAGCTGCGCAGGCAGCAGTACGAGCAGTGCATGGACCTGCAGCTCTTCTACCGGGACACTGAGCAGGTGGACAACTGGATGAGCAAGCAGGAGGCGTTCCTGTTGAATGAAGACTTGGGAGATTCCTTGGATAGTGTGGAAGCGCTTCTTAAGAAGCACGAAGACTTTGAGAAATCCCTTAGTGCCCAGGAGGAAAAGATTACAGCATTAGATGAATTTGCAACCAAGCTAATTCAGAACAACCACTATGCAATGGAAGATGTGGCCACTCGCCGAGATGCTCTGTTGAGCCGCCGCAATGCCCTTCACGAGAGAGCCATGCGTCGCCGGGCCCAGCTAGCCGATTCTTTCCATCTGCAGCAGTTTTTCCGTGATTCTGATGAGCTCAAGAGTTGGGTCAATGAGAAGATGAAAACTGCCACAGATGAAGCTTATAAAGATCCATCCAACCTACAAGGAAAAGTACAGAAGCATCAGGCTTTTGAGGCTGAGCTCTCAGCAAACCAGAGCCGAATTGATGCCTTGGAGAAAGCTGGCCAAAAGCTGATTGATGTCAACCACTATGCCAAGGATGAAGTGGCAGCTCGTATGAATGAGGTGATCAGTTTGTGGAAGAAACTGCTAGAGGCCACTGAACTGAAAGGAATAAAGCTTCGTGAAGCCAACCAGCAACAGCAATTTAATCGCAATGTTGAGGATATTGAATTGTGGCTATATGAAGTAGAAGGTCACTTGGCTTCGGATGATTACGGCAAAGATCTTACCAATGTGCAGAACCTCCAGAAGAAACATGCACTGCTAGAGGCAGATGTGGCTGCTCACCAGGACCGAATTGATGGCATCACCATTCAGGCCCGCCAGTTCCAAGATGCTGGCCATTTTGATGCAGAAAACATCAAGAAGAAACAGGAAGCCCTCGTGGCTCGCTATGAGGCACTCAAGGAGCCCATGGTTGCCCGGAAGCAGAAGCTGGCCGATTCTCTGCGGTTGCAGCAGCTCTTCCGGGATGTTGAGGATGAGGAGACGTGGATTCGAGAGAAAGAGCCCATTGCCGCATCTACCAACAGAGGTAAGGATTTAATTGGGGTCCAGAATCTGCTAAAGAAACATCAAGCCTTACAAGCAGAAATTGCTGGACATGAACCACGCATCAAAGCAGTTACACAGAAGGGGAATGCCATGGTGGAGGAAGGCCATTTTGCTGCAGAGGATGTGAAGGCCAAGCTTCACGAGCTGAACCAAAAGTGGGAGGCACTGAAAGCCAAAGCTTCCCAGCGTCGGCAGGACCTGGAGGACTCTCTGCAGGCCCAGCAGTACTTTGCTGATGCTAACGAGGCTGAATCCTGGATGCGGGAGAAGGAACCCATTGTGGGCAGCACTGACTATGGCAAGGACGAAGACTCTGCTGAGGCTCTACTGAAGAAACACGAAGCTTTGATGTCAGATCTCAGTGCCTACGGCAGCAGCATCCAGGCTTTGCGAGAACAAGCACAGTCCTGCCGGCAACAAGTGGCCCCCACGGATGATGAGACTGGGAAGGAGCTGGTCTTGGCTCTCTACGACTATCAGGAGAAGAGTCCCCGAGAGGTCACCATGAAGAAGGGAGATATCCTTACCTTACTCAACAGCACCAACAAGGATTGGTGGAAAGTGGAAGTGAACGATCGTCAGGGTTTTGTGCCGGCTGCGTACGTGAAGAAATTGGACCCCGCCCAGTCAGCCTCCCGGGAGAATCTCCTGGAGGAGCAAGGCAGCATAGCACTGCGGCAGGAGCAGATTGACAATCAATATCATTCTCTGCTGGAACTGGGTGAGAAGCGTAAAGGCATGTTGGAGAAGAGTTGCAAGAAGTTTATGTTGTTCCGTGAAGCGAATGAACTACAGCAATGGATCAATGAGAAGGAAGCCGCTCTGACAAGTGAGGAGGTCGGAGCAGACTTGGAGCAGGTTGAGGTGCTCCAGAAGAAGTTTGATGACTTCCAGAAGGACCTGAAGGCCAATGAGTCACGGTTGAAGGACATTAACAAGGTAGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCTGTGCAACAACAGGAAGTGTATGGCATGATGCCCAGGGATGAAACTGATTCCAAGACAGCCTCCCCGTGGAAGTCTGCTCGTCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGCTGGCGGTCCCTACAGCAGCTGGCCGAGGAACGGAGCCAGCTCTTGGGCAGCGCCCATGAAGTACAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAATGGATTGAAGAGAAGAATCAAGCTCTAAACACAGACAATTATGGACATGATCTCGCCAGTGTCCAGGCCCTGCAACGCAAGCATGAGGGCTTCGAGAGGGACCTTGCGGCTCTCGGTGACAAGGTAAACTCCCTTGGTGAAACAGCAGAGCGCCTGATCCAGTCCCATCCCGAGTCAGCAGAAGACCTGCAGGAAAAGTGCACAGAGTTAAACCAGGCCTGGAGCAGCCTGGGGAAACGTGCAGATCAGCGCAAGGCAAAGTTGGGTGACTCCCACGACCTGCAGCGCTTCCTTAGCGATTTCCGGGACCTCATGTCTTGGATCAATGGAATACGGGGGTTGGTGTCCTCAGATGAGCTAGCCAAGGATGTCACCGGAGCTGAGGCATTGCTGGAGCGACACCAGGAACACCGGACAGAAATCGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGACAGCAGCTGTTGGCTCACGGACACTATGCCAGCCCTGAGATCAAGCAGAAACTTGATATTCTTGACCAGGAGCGTGCAGACCTGGAGAAGGCCTGGGTTCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTCCATCGGGACTGTGAGCAAGCTGAGAACTGGATGGCTGCCCGGGAGGCCTTCTTGAATACCGAAGACAAAGGAGACTCACTGGACAGCGTAGAGGCTCTGATCAAAAAACATGAAGACTTTGACAAAGCGATTAACGTCCAGGAAGAGAAGATTGCTGCTCTGCAGGCCTTTGCCGACCAGCTCATCGCTGCCGGCCATTATGCCAAGGGAGACATTTCTAGCCGGCGCAATGAGGTCTTGGACAGGTGGCGACGTCTGAAAGCCCAGATGATTGAGAAAAGGTCAAAGCTAGGAGAATCTCAAACCCTCCAACAGTTCAGCCGGGATGTGGATGAGATTGAGGCTTGGATCAGTGAAAAATTGCAAACAGCGAGTGATGAGTCGTACAAGGATCCCACCAACATCCAGAGCAAGCACCAGAAGCACCAGGCTTTTGAAGCAGAGCTGCATGCCAACGCTGACCGGATCCGTGGGGTTATCGACATGGGCAACTCCCTCATTGAACGTGGAGCCTGTGCCGGCAGTGAGGATGCTGTCAAGGCCCGCCTGGCTGCCTTAGCTGACCAGTGGCAGTTCTTGGTGCAAAAGTCAGCGGAAAAGAGCCAGAAACTGAAAGAAGCCAACAAGCAGCAGAACTTCAACACAGGGATCAAGGACTTTGACTTCTGGCTGTCTGAGGTGGAGGCCCTGCTGGCATCCGAAGATTATGGCAAAGACCTAGCTTCTGTGAACAACCTGCTGAAAAAGCATCAACTGCTGGAAGCAGATATATCTGCCCATGAGGATCGCCTGAAGGACCTGAACAGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCAAGTAAAGGACAAGAGGGACACCATCAACGGGCGCTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGGGCTCAGAGGACTACGGCCGGGACCTAACCGGCGTGCAGAACCTGAGGAAGAAGCACAAGCGGCTGGAAGCAGAACTGGCTGCGCATGAGCCGGCTATTCAGGGTGTCCTGGACACTGGCAAGAAGCTGTCCGATGACAACACCATCGGGAAAGAGGAGATCCAGCAGCGGCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCAGCTGCCCGGGGTCAGCGGCTGGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAATGTGGAAGAGGAAGAAGCCTGGATCAATGAGAAAATGACCCTGGTGGCCAGCGAAGATTATGGCGACACTCTTGCCGCCATCCAGGGCTTACTGAAGAAACATGAAGCTTTTGAGACAGACTTCACCGTCCACAAGGATCGCGTGAATGATGTCTGCACCAATGGACAAGACCTCATTAAGAAGAACAATCACCATGAGGAGAACATCTCTTCAAAGATGAAGGGCCTGAACGGGAAAGTGTCAGACCTGGAGAAAGCTGCAGCCCAGAGAAAGGCGAAGCTGGATGAGAACTCGGCCTTCCTTCAGTTCAACTGGAAGGCGGACGTGGTGGAGTCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGATTATGGCCGAGACCTGTCTTCTGTGCAGACGCTCCTCACCAAACAGGAAACTTTTGACGCTGGGCTGCAGGCCTTCCAGCAGGAAGGCATTGCCAACATCACTGCCCTCAAAGATCAGCTTCTCGCCGCCAAACACGTTCAGTCCAAGGCCATCGAGGCCCGGCACGCCTCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCGCCCGCAAGAAGAAGCTTCTGGAGGCTCAGAGTCACTTCCGCAAGGTGGAGGACCTCTTCCTGACCTTCGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAATGCAGAGGAGGACTTAACAGACCCCGTGCGCTGCAACTCCTTGGAAGAAATCAAAGCTTTGCGCGAGGCCCACGACGCCTTCCGCTCCTCCCTCAGCTCTGCCCAGGCTGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTAGCCTCCAACCCCTACACCTGGTTTACCATGGAGGCCCTGGAGGAGACCTGGAGGAACCTACAGAAAATCATCAAGGAGAGGGAGCTGGAGCTGCAGAAGGAACAGCGGCGGCAGGAGGAGAACGACAAGCTGCGCCAGGAGTTTGCCCAGCACGCCAACGCCTTCCACCAGTGGATCCAAGAGACCAGGACATACCTCCTCGATGGGTCCTGTATGGTGGAAGAGTCGGGGACCCTCGAATCCCAGCTTGAAGCTACCAAACGCAAGCACCAGGAAATCCGAGCCATGAGAAGTCAGCTCAAAAAGATCGAGGACCTGGGGGCCGCCATGGAGGAGGCCCTCATCCTGGACAACAAGTACACGGAGCACAGCACCGTGGGCCTCGCCCAGCAGTGGGACCAGCTGGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACAACAGGTGTGACTGAGGAGGCCCTCAAAGAATTCAGCATGATGTTTAAACACTTTGACAAGGACAAGTCTGGCAGGCTGAACCATCAGGAGTTCAAATCTTGCCTGCGCTCCCTGGGCTATGACCTGCCCATGGTGGAGGAAGGGGAACCTGACCCTGAGTTCGAGGCAATCCTGGACACGGTGGATCCGAACAGAGATGGCCATGTCTCCTTGCAAGAATACATGGCTTTCATGATCAGCCGCGAAACTGAGAACGTCAAGTCCAGCGAGGAGATTGAGAGCGCCTTCCGGGCCCTCAGCTCAGAGGGAAAGCCTTACGTGACCAAGGAGGAGCTCTACCAGAACCTGACCCGGGAACAAGCCGACTACTGCGTCTCCCACATGAAGCCCTACGTGGACGGCAAGGGCCGCGAGCTCCCCACCGCGTTCGACTACGTGGAGTTCACCCGCTCGCTTTTCGTGAACTGAGCCACTCCCTGGGTCACCCACCCCTCGCTGCTTGCCCTGCGTCGCCTTGCTGCATGTCCGCTCCTCTGTGTGCTCTCACTTTCCACTGTAACCTTAAGCCTGCTTAGCTTGGAATAAGACTTAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGGACCCAGATCTGTGTCTTGAAGCAGCTGCCCTCATTCCGACTTCAGAAAATCGAAGCAGCTGGCTCCTCCCCTTGTTCTCTCTCCCACCCTCCCCCAAATCTGTTTTCATGTAAAAGACAAATAAATGATGACTTCCCCCA