Transcript asmbl_13192

Sequence
Transcript Sequence for observation asmbl_13192 of TGE0058271:
CCGAGCTGGCCGGCGAGCGGGCGGCTGCGGGCGGCGCGGAGCGGGCGGCGCGGAGCGAGCGAGCGAGAGAGCGGCGCGGGCCGGGCCATGGGGTGGCGGGCGGCGGGCGCGCTGCTGCTGGCGCTGCTGCTGCACGGGCGGCTGCTGGCGGTGACCCATGGGCTGAGGGCATACGATGGCTTGTCTCTGCCTGAGGACATAGAGACCGTCACAGCAAGCCAAATGCGCTGGACACATTCGTACCTTTCTGATGATGAGGACATGCTGGCTGACAGCATCTCAGGAGACGACCTGGGCAGTGGGGACCTGGGCAGCGGGGACTTCCAGATGGTTTATTTCCGAGCCCTGGTGAATTTCACTCGCTCCATCGAGTACAGCCCTCAGCTGGAGGATGCAGGCTCCAGAGAGTTCCGAGAGGTGTCCGAGGCTGTGGTAGACACGCTGGAGTCGGAGTACTTGAAAATTCCCGGAGACCAGGTTGTCAGTGTGGTGTTCATCAAGGAGCTGGATGGCTGGGTTTTTGTGGAGCTGGATGTGGGCTCGGAAGGGAATGCGGATGGGGCTCAGATTCAGGAGATGCTGCTCAGGGTCATCTCCAGCGGCTCTGTGGCCTCCTACGTCACCTCTCCCCAGGGATTCCAGTTCCGACGCCTGGGCACAGTGCCCCAGTTCCCAAGAGCCTGCACGGAGGCCGAGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTGGCGCTGCGATGGTGACTTTGACTGTGAGGACCGAACTGATGAAGCCAACTGCCCCACCAAGCGTCCTGAGGAAGTGTGCGGGCCCACACAGTTCCGATGCGTCTCTACCAACATGTGCATCCCAGCCAGCTTCCACTGTGACGAGGAGAGCGACTGTCCTGACCGGAGCGACGAGTTTGGCTGCATGCCCCCCCAGGTGGTGACACCTCCCCGGGAGTCCATCCAGGCTTCCCGGGGCCAGACAGTGACCTTCACCTGCGTGGCCATTGGCGTCCCCACCCCCATCATCAATTGGAGGCTCAACTGGGGCCACATCCCCTCTCATCCCAGGGTGACAGTGACCAGCGAGGGTGGCCGTGGCACACTGATCATCCGTGATGTGAAGGAGTCAGACCAGGGTGCCTACACCTGTGAGGCCATGAACGCCCGGGGCATGGTGTTTGGCATTCCTGACGGTGTCCTTGAGCTCGTCCCACAACGAGGCCCCTGCCCTGACGGCCACTTCTACCTGGAGCACAGCGCCGCCTGCCTGCCCTGCTTCTGCTTTGGCATCACCAGCGTGTGCCAGAGCACCCGCCGCTTCCGGGACCAGATCAGGCTGCGCTTTGACCAACCCGATGACTTCAAGGGTGTGAATGTGACAATGCCTGCGCAGCCCGGCACGCCACCCCTCTCCTCCACGCAGCTGCAGATCGACCCATCCCTGCACGAGTTCCAGCTAGTCGACCTGTCCCGCCGCTTCCTCGTCCACGACTCCTTCTGGGCTCTGCCTGAACAGTTCCTGGGCAACAAGGTGGACTCCTATGGCGGCTCCCTGCGTTACAACGTGCGCTACGAGTTGGCCCGTGGCATGCTGGAGCCAGTGCAGCGGCCGGACGTGGTCCTCATGGGTGCCGGGTACCGCCTCCTCTCCCGAGGCCACACACCCACCCAACCTGGTGCTCTGAACCAGCGCCAGGTCCAGTTCTCTGAGGAGCACTGGGTCCATGAGTCTGGCCGGCCGGTGCAGCGCGCGGAGCTGCTGCAGGTGCTGCAGAGCCTGGAGGCCGTGCTCATCCAGACCGTGTACAACACCAAGATGGCCAGCGTGGGACTTAGCGACATCGCCATGGATACCACCGTCACCCATGCCACCAGCCATGGCCGTGCCCACAGTGTGGAGGAGTGCAGATGCCCCATTGGCTATTCTGGCTTGTCCTGCGAGAGCTGTGATGCCCACTTCACTCGGGTGCCTGGTGGGCCCTACCTGGGCACCTGCTCTGGTTGCAATTGCAATGGCCATGCCAGCTCCTGTGACCCTGTGTATGGCCACTGCCTGAATTGCCAGCACAACACGGAGGGGCCACAGTGCAACAAGTGCAAGGCTGGCTTCTTTGGGGACGCCATGAAGGCCACGGCCACTTCCTGCCGGCCCTGCCCTTGCCCATACATCGATGCCTCCCGCAGATTCTCAGACACTTGCTTCCTGGACACGGATGGCCAAGCCACATGTGACGCCTGTGCCCCAGGCTACACTGGCCGCCGCTGTGAGAGCTGTGCCCCCGGATACGAGGGCAACCCCATCCAGCCCGGCGGGAAGTGCAGGCCCGTCAACCAGGAGATTGTGCGCTGTGACGAGCGTGGCAGCATGGGGACCTCCGGGGAGGCCTGCCGCTGTAAGAACAATGTGGTGGGGCGCTTGTGCAATGAATGTGCTGACGGCTCTTTCCACCTGAGTACCCGAAACCCCGATGGCTGCCTCAAGTGCTTCTGCATGGGTGTCAGTCGCCACTGCACCAGCTCTTCATGGAGCCGTGCCCAGTTGCATGGGGCCTCTGAGGAGCCTGGTCACTTCAGCCTGACCAACGCCGCAAGCACCCACACCACCAACGAGGGCATCTTCTCCCCCACGCCCGGGGAACTGGGATTCTCCTCCTTCCACAGACTCTTATCTGGACCCTACTTCTGGAGCCTCCCTTCACGCTTCCTGGGGGACAAGGTGACCTCCTATGGAGGAGAGCTGCGCTTCACAGTGACCCAGAGGTCCCAGCCGGGCTCCACACCCCTGCACGGGCAGCCGTTGGTGGTGCTGCAAGGTAACAACATCATCCTAGAGCACCATGTGGCCCAGGAGCCCAGCCCCGGCCAGCCCAGCACCTTCATTGTGCCTTTCCGGGAGCAAGCATGGCAGCGGCCCGATGGGCAGCCAGCCACACGGGAGCACCTGCTGATGGCACTGGCAGGCATCGACACCCTCCTGATCCGAGCATCCTACGCCCAGCAGCCCGCTGAGAGCAGGGTCTCTGGCATCAGCATGGACGTGGCTGTGCCCGAGGAAACCGGCCAGGACCCCGCGCTGGAAGTGGAACAGTGCTCCTGCCCACCCGGGTACCGTGGGCCGTCCTGCCAGGACTGTGACACAGGCTACACACGCACGCCCAGTGGCCTCTACCTGGGTACCTGTGAACGCTGCAGCTGCCATGGCCACTCAGAGGCCTGCGAGCCAGAAACAGGTGCCTGCCAGGGCTGCCAGCATCACACGGAGGGCCCTCGGTGTGAGCAGTGCCAGCCAGGATACTACGGGGACGCCCAGCGGGGGACACCACAGGACTGCCAGCTGTGCCCCTGCTACGGAGACCCTGCTGCCGGCCAGGCTGCCCACACTTGTTTTCTGGACACAGACGGCCACCCCACCTGTGATGCGTGCTCCCCAGGCCACAGTGGGCGTCACTGTGAGAGGTGCGCCCCTGGCTACTATGGCAACCCCAGCCAGGGCCAGCCATGCCAGAGAGACAGCCAGGTGCCAGGGCCCATAGGCTGCAACTGTGACCCCCAAGGCAGCGTCAGCAGCCAGTGTGATGCTGCTGGTCAGTGCCAGTGCAAGGCCCAGGTGGAAGGCCTCACTTGCAGCCACTGCCGGCCCCACCACTTCCACCTGAGTGCCAGCAACCCAGACGGCTGCCTGCCCTGCTTCTGTATGGGCATCACCCAGCAGTGCGCCAGCTCTGCCTACACACGCCACCTGATCTCCACCCACTTTGCCCCTGGGGACTTCCAAGGCTTTGCCCTGGTGAACCCACAGCGAAACAGCCGCCTGACAGGAGAATTCACTGTGGAACCCGTGCCCGAGGGTGCCCAGCTCTCTTTTGGCAACTTTGCCCAACTCGGCCATGAGTCCTTCTACTGGCAGCTGCCGGAGACATACCAGGGAGACAAGGTGGCGGCCTACGGTGGGAAGTTGCGATACACCCTCTCCTACACAGCAGGCCCACAGGGCAGCCCACTCTCTGACCCCGATGTGCAGATCACGGGCAACAACATCATGCTAGTGGCCTCCCAGCCAGCGCTGCAGGGCCCTGAGAGGAGGAGCTACGAGATCATGTTCCGAGAGGAATTCTGGCGCCGGCCCGATGGGCAGCCGGCCACACGCGAGCACCTCCTGATGGCACTGGCCGACCTGGATGAGCTCCTGATCCGGGCCACGTTCTCCTCCGTGCCGCTGGCGGCCAGCATCAGCGCAGTCAGCCTGGAGGTCGCCCAGCCGGGGCCCTCAAACAGACCCCGCGCCCTCGAGGTGGAGGAGTGCCGCTGCCCGCCAGGCTACATCGGTCTGTCCTGCCAGGACTGTGCCCCCGGCTACACGCGCACCGGGAGTGGGCTCTACCTCGGCCACTGCGAGCTATGTGAATGCAATGGCCACTCAGACCTGTGCCACCCAGAGACTGGGGCCTGCTCGCAATGCCAGCACAACGCCGCAGGGGAGTTCTGCGAGCTTTGTGCCCCTGGCTACTACGGAGATGCCACAGCCGGGACGCCTGAGGACTGCCAGCCCTGTGCCTGCCCACTGACCAACCCAGAGAACATGTTTTCCCGCACCTGTGAGAGCCTGGGAGCCGGCGGGTACCGCTGCACGGCCTGCGAACCCGGCTACACTGGCCAGTACTGTGAGCAGTGTGGCCCAGGTTACGTGGGTAACCCCAGTGTGCAAGGGGGCCAGTGCCTGCCAGAGACAAACCAAGCCCCACTGGTGGTCGAGGTCCATCCTGCTCGAAGCATAGTGCCCCAAGGTGGCTCCCACTCCCTGCGGTGTCAGGTCAGTGGGAGCCCACCCCACTACTTCTATTGGTCCCGTGAGGATGGGCGGCCTGTGCCCAGCGGCACCCAGCAGCGACATCAAGGCTCCGAGCTCCACTTCCCCAGCGTCCAGCCCTCGGATGCTGGGGTCTACATTTGCACCTGCCGTAATCTCCACCAATCCAATACCAGCCGGGCAGAGCTGCTGGTCACTGAGGCTCCAAGCAAGCCCATCACAGTGACTGTGGAGGAGCAGCGGAGCCAGAGCGTGCGCCCCGGAGCTGACGTCACCTTCATCTGCACAGCCAAAAGCAAGTCCCCAGCCTATACCCTGGTGTGGACCCGCCTGCACAACGGGAAACTGCCCACCCGAGCCATGGATTTCAATGGCATCCTGACCATTCGCAACGTCCAGCTGAGTGATGCAGGCACCTACGTGTGCACCGGCTCCAACATGTTTGCCATGGACCAGGGCACAGCCACTCTACATGTGCAGGCCTCGGGCACCTTGTCCGCCCCCGTGGTCTCCATCCATCCGCCACAGCTCACAGTGCAGCCCGGGCAACTGGCGGAGTTCCGCTGCAGCGCCACAGGGAGCCCCACGCCCACCCTCGAGTGGACAGGGGGCCCCGGCGGCCAGCTCCCTGCGAAGGCACAAATCCACGGCGGCATCCTGCGCCTGCCAGCTGTCGAGCCCACGGATCAGGCCCAGTACTTGTGCCGAGCCCACAGCAGCGCTGGGCAGCAGGTGGCCAGGGCTGTGCTCCACGTGCATGGGGGCGGTGGGCCCAGAGTCCAAGTGAGCCCAGAGAGGACCCAGGTCCACGCAGGCCGCACCGTCAGGCTGTACTGCAGGGCTGCAGGCGTGCCTAGCGCCACCATCACCTGGAGGAAGGAAGGGGGCAGCCTCCCACCACAGGCCCGGTCAGAGCGCACAGACATCGCGACACTGCTCATCCCAGCCATCACGACTGCTGACGCCGGCTTCTACCTCTGCGTGGCCACCAGCCCTGCAGGCACTGCCCAGGCCCGGATCCAAGTGGTTGTCCTTTCAGCCTCAGATGCCAGCCCACCGCCGGTCAAGATTGAGTCCTCATCGCCTTCTGTGACAGAAGGGCAAACACTCGACCTCAACTGTGTGGTGGCAGGGTCAGCCCATGCCCAGGTCACCTGGTACAGGCGAGGGGGTAGCCTGCCTCCCCACACCCAGGTGCACGGCTCCCGTCTGCGGCTCCCCCAGGTCTCACCAGCTGATTCTGGAGAATATGTGTGCCGTGTGGAGAATGGATCGGGCCCCAAGGAGGCCTCCATTACTGTGTCTGTGCTCCACGGCACCCATTCTGGCCCCAGCTACACCCCAGTGCCCGGCAGCACCCGGCCCATCCGCATCGAGCCCTCCTCCTCACACGTGGCGGAAGGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGTCCCATGCCCAGGTCACGTGG