Transcript asmbl_128194

Sequence
Transcript Sequence for observation asmbl_128194 of TGE0056441:
GCTCCCCTTGCTTTCCGCGGCATTCTTTGGGCGTGAGTCATGCAGGTTTGCAGCCAGCCCCAAAGGGGGTGTGTGCGCGAGCAGAGCGCTATAAATACGGCGCCTCCCAGTGCCCACAACGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCGCTGACCGAGGCGTGCAAAGACTCCAGAATTGGAGGCATGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCAGACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGACGAGCTCTTCCAGGACAGGTTCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCCTTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCCCTTCCTTGAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAGCACCCGCCAACAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATCCGCCACAACTCCACGGGCTGCCTGCGGATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCTGCGGCGGGAGCTCGACGAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCCGGCTGGCAAACCTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACGGTGGCTTCCCACACTTCTGACTCGGACGTTCCTTCCGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGAAGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAGGAGTGAGATGTGGATGTTGCTTTTGCACCTACGGGGGCATCTGAGTCCAGCTCCCCCCAAGATGAGCTGCAGCCCCCCAGAGAGAGCTCTGCACGTCACCAAGTAACCAGGCCCCAGCCTCCAGGCCCCCAACTCCGCCCAGCCTCTCCCCGCTCTGGATCCTGCACTCTAACACTCGACTCTGCTGCTCATGGGAAGAACAGAATTGCTCCTGCATGCAACTAATTCAATAAAACTGTCTTGTGAGCTGATCGCTTGGAGGGTCCTCTTTTTATGTTGAGTTGCTGCTTCCCGGCATGCCTTCATTTTGCTATGGGGGGCAGGCAGGGGGGATGGAAAATAAGTAGAAACAAAAAAGCAGTGGCTAAGATGGTATAGGGACTGTCATACCAGTGAAGAATAAAAGGGTGAAGAATAAAAGGGATATGATGACAAGGTTGATCCACTTCAAGAATTGCTTGCTTTCAGGAAGAGAGATGTGTTTCAACAAGCCAACTAAAATATATTGCTGCAAATGGAAGCTTTTCTGTTCTATTATAAAACTGTCGATGTATTCTGACCAAGGTGCGACAATCTCCTAAAGGAATACACTGAAAGTTAAGGAGAAGAATCAGTAAGTGTAAGGTGTACTTGGTATTATAATGCATAATTGATGTTTTCGTTATGAAAACATTTGGTGCCCAGAAGTCCAAATTATCAGTTTT