Transcript asmbl_127741

Sequence
Transcript Sequence for observation asmbl_127741 of TGE0056091:
CTCTTATCTGATCCTGGGCTCCCAGCTGGAGAGGCGGAGGCAGCTCCAGGGGGCTGGAAGTGGAAGCGCAGCGGCAGAAGGAGAGGGAGAGAGAAAGAGAGAGAGGCTAATTAAAAAAGGATACTCCGAGGGAAGAGAGCAAGGGCGGTGCGCCGCCAAGGACCAACTAGCGGCGGAGCTTCGATCTTGCCTAGGCGCGGAGAGCTCCCAACCTGGGCTGGAACCTTGCCCAGCACAGGTGGCTGCTACACCCCATGTAAAAAGCGGAAAATAAAATGAAGATTTTCCAGCGCAAGATGCGGTACTGGTTGCTTCCACCTTTTTTGGCAATTGTTTATTTCTGCACCATTGTCCAAGGTCAAGTGGCTCCACCCACAAGGTTAAGATATAATGTAATATCTCATGACAGTATACAGATTTCATGGAAGGCTCCAAGAGGGAAATTTGGTGGTTACAAACTTCTTGTGACTCCAACTTCAGGTGGAAAAACTAACCAGCTGAATCTGCAGAACACTGCAACTAAAGCAATTATTCAAGGCCTTATGCCAGACCAGAATTACACAGTTCAAATTATTGCATACAATAAAGATAAAGAAAGCAAGCCAGCTCAAGGCCAATTCAGAATTAAAGATTTAGAAAAAAGAAAGGATCCAAAGCCCAGAGTCAAAGTTGTGGACAGAGGAAATGGGAGTAGACCATCTTCACCAGAAGAAGTGAAATTTGTCTGTCAAACTCCAGCAATTGCTGACATTGTAATCCTGGTCGATGGTTCATGGAGTATTGGAAGATTCAACTTCAGACTGGTTCGGCATTTCTTGGAAAACCTGGTTACAGCATTCGATGTGGGCTCAGAGAAGACACGAATTGGTCTTGCACAGTATAGTGGTGACCCCAGAATAGAATGGCACTTGAATGCATTTAGCACAAAAGATGAAGTGATTGAAGCTGTCCGAAACCTCCCATATAAAGGAGGAAATACACTAACAGGTCTTGCTTTGAACTACATTTTTGAAAATAGCTTCAAACCAGAAGCAGGATCAAGGACTGGAGTATCCAAAATTGGCATTTTAATCACAGATGGAAAATCCCAAGATGACATTATTCCACCATCTAGAAATCTTCGTGAGTCTGGTGTAGAACTGTTTGCCATAGGGGTGAAAAACGCGGATGTGAATGAGCTGCAGGAGATCGCCTCTGAACCAGACAGCACTCATGTGTACAATGTTGCCGAATTCGATCTGATGCACACAGTTGTGGAGAGTCTGACCAGGACTCTCTGCTCTAGAGTGGAAGAACAGGACAGAGAAATTAAAGCCTCAGCCCATGCCATCACTGGGCCGCCTACGGAGTTGATTACTTCTGAAGTCACTGCCAGAAGCTTTATGGTTAACTGGACTCATGCCCCAGGAAATGTGGAAAAATACAGAGTTGTGTATTATCCTACCAGGGGTGGAAAACCAGACGAGGTGGTGGTAGATGGAACTGTATCTTCCACAGTGTTGAAAAACTTGATGTCTTTAACTGAATATCAGATAGCAGTCTTTGCAATCTATGCCCACACTGCTAGTGAAGGCCTACGGGGAACTGAAACTACACTTGCTTTACCGATGGCTTCTGACCTTCTACTGTACGACGTGACTGAGAACAGCATGCGAGTCAAATGGGATGCAGTGCCTGGGGCCTCAGGTTACCTGATCCTTTATGCTCCTCTAACAGAGGGCCTGGCTGGGGATGAAAAAGAGATGAAAATTGGAGAGACCCACACAGATATTGAATTGAGTGGGTTGTTGCCCAATACAGAATACACAGTCACAGTTTATGCCATGTTTGGAGAAGAGGCCAGTGATCCTGTTACGGGACAAGAAACAACATTGGCTTTAAGTCCACCAAGAAACCTGAGAATCTCCAATGTTGGCTCTAACAGTGCTCGATTAACCTGGGACCCAACTTCAAGACAGATCAATGGTTATCGAATTGTATATAACAATGCAGATGGGACTGAAATCAATGAGGTTGAAGTCGATCCTATTACTACCTTCCCTCTGAAGGGCTTGACACCTCTCACAGAGTATACTATTGCTATTTTCTCCATCTATGATGAAGGACAGTCAGAGCCTCTGACTGGAGTTTTTACCACCGAGGAAGTTCCAGCCCAGCAATACTTAGAAATTGATGAGGTGACGACAGACAGTTTTAGGGTGACCTGGCATCCCCTCTCAGCTGATGAAGGGCTACACAAATTGATGTGGATTCCAGTCTATGGGGGGAAGACTGAGGAGGTTGTCCTGAAAGAAGAGCAGGACTCACATGTTATTGAAGGCCTGGAGCCCGGTACGGAGTATGAAGTTTCACTATTGGCCGTACTTGATGATGGAAGCGAGAGTGAGGTGGTGACTGCTGTCGGGACCACACTTGACAGTTTTTGGACAGAACCAGCTACAACCATAGTGCCTACCACATCTGTGACTTCAGTTTTCCAGACGGGAATCAGAAACCTAGTTGTAGGTGATGAAACTACTTCTAGCCTGCGGGTAAAATGGGACATTTCTGACAGCGATGTGCAGCAGTTTAGGGTGACCTACATGACAGCTCAAGGGGACCCTGAGGAAGAAGTCATAGGAACGGTTATGGTGCCTGGAAGCCAGAACAACCTCCTTCTGAAGCCTCTGCTTCCTGATACTGAATACAAAGTCACAGTGACTCCCATCTACACGGATGGCGAAGGCGTCAGCGTCTCCGCTCCTGGAAAAACCTTACCATCCTCGGGGCCCCAGAACTTGCGGGTGTCCGAGGAATGGTATAACCGGTTGCGCATTACGTGGGACCCCCCATCTTCCCCGGTGAAAGGCTATAGAATTGTCTACAAACCTGTCAGTGTTCCTGGTCCAACACTGGAAACGTTTGTGGGAGCTGACATTAACACCATCCTTATCACAAACCTCCTCAGCGGAATGGACTACAATGTGAAGATATTTGCCTCCCAGGCCTCAGGCTTCAGCGACGCCCTGACAGGCATGGTGAAAACATTGTTCTTGGGTGTTACCAATCTCCAAGCCAAACATGTTGAAATGACCAGCTTGTGTGCCCACTGGCAGGTACATCGCCATGCCACAGCCTATAGGGTTGTTATAGAATCCCTCCAGGATAGGCAAAAGCAAGAATCCACTGTGGGTGGAGGGACAACCAGGCATTGCTTCTATGGACTTCAGCCTGATTCTGAATATAAAATCAGTGTTTATACAAAGCTCCAGGAGATTGAAGGACCTAGTGTGAGCATAATGGAAAAAACACAATCACTTCCTACACGACCACCAACTTTTCCTCCAACCATTCCACCAGCAAAAGAAGTATGTAAGGCGGCCAAGGCTGACCTGGTATTTATGGTGGATGGATCCTGGAGCATTGGAGATGAAAATTTCAATAAGATCATCAGCTTTCTATACAGCACTGTTGGAGCCCTGAACAAGATTGGCACAGATGGAACCCAAGTTGCAATGGTTCAGTTCACTGATGATCCCAGAACAGAATTTAAACTAAATGCTTACAAAACCAAAGAGACTCTTCTTGATGCAATTAAACACATTTCATACAAAGGAGGAAATACAAAAACAGGAAAAGCAATTAAGTATGTTCGAGATACCTTGTTCACTGCAGAGTCAGGTACAAGAAGGGGCATCCCAAAGGTTATCGTGGTTATAACTGATGGAAGATCACAAGATGATGTGAACAAAATCTCCAGGGAGATGCAATTAGATGGCTATAGCATTTTTGCAATTGGTGTGGCCGATGCAGATTACTCGGAGTTGGTTAGCATTGGCAGTAAGCCCAGCGCACGCCATGTCTTCTTTGTGGATGACTTTGACGCCTTTAAGAAAATCGAAGATGAGTTAATTACTTTTGTCTGCGAAACAGCATCAGCAACCTGTCCAGTGGTACACAAGGATGGCATTGATCTTGCAGGATTTAAGATGATGGAAATGTTTGGTTTGGTTGAAAAAGATTTTTCATCAGTGGAAGGGGTTTCTATGGAGCCTGGTACCTTCAATGTGTTTCCATGTTACCAACTCCATAAAGATGCCCTGGTTTCCCAGCCAACCAGGTACTTGCACCCAGAAGGATTGCCCTCCGACTACACAATCAGTTTTCTATTCCGGATTCTTCCTGACACTCCACAGGAGCCATTTGCTCTTTGGGAGATTTTAAATAAAAATTCTGACCCATTGGTTGGGGTTATTTTAGACAATGGTGGGAAAACTCTAACATATTTCAACTATGACCAGAGTGGGGATTTTCAAACTGTTACTTTCGAAGGACCTGAAATTAGGAAAATTTTTTATGGAAGCTTTCACAAGCTACACATTGTTGTCAGTGAGACTTTGGTCAAAGTGGTTATTGACTGCAAGCAAGTGGGTGAGAAGGCAATGAACGCATCAGCTAATATCACGTCAGATGGTGTAGAAGTGCTAGGGAAAATGGTTCGATCAAGAGGACCAGGTGGAAACTCTGCACCGTTCCAGTTACAGATGTTTGATATTGTTTGCTCCACATCATGGGCCAATACAGACAAATGCTGTGAACTTCCAGGCCTGAGAGATGATGAGTCTTGCCCAGACCTTCCCCATTCCTGCTCCTGTTCTGAAACCAATGAAGTGGCTCTGGGACCAGCGGGCCCACCAGGTGGTCCAGGACTCCGAGGACCAAAGGGCCAGCAAGGTGAACCGGGTCCAAAGGGACCAGATGGCCCTCGGGGTGAAATTGGTCTGCCAGGACCTCAGGGTCCACCTGGACCTCAAGGACCAAGTGGTCTGTCCATTCAAGGAATGCCCGGAATGCCAGGAGAAAAAGGAGAGAAAGGAGATACTGGCCTTCCAGGTCCACAGGGTATCCCAGGAGGCGTTGGTTCACCAGGACGTGATGGCTCACCAGGCCAGAGGGGCCTTCCGGGAAAGGATGGATCCTCGGGACCTCCAGGACCACCAGGGCCAATAGGCATTCCTGGCACCCCTGGAGTCCCAGGGATCACAGGAAGCATGGGACCGCAAGGCGCCCTGGGACCACCTGGTGTCCCTGGAGCAAAGGGGGAACGAGGAGAGCGGGGTGACCTGCAGTCTCAAGCCATGGTGAGATCAGTGGCGCGTCAAGTATGCGAACAGCTCATCCAGAGTCACATGGCCAGGTACACTGCCATCCTCAACCAGATTCCCAGCCACTCCTCATCCATCCGGACTGTCCAAGGGCCTCCTGGGGAGCCTGGGAGGCCAGGCTCACCTGGAGCCCCTGGTGAACAAGGACCCCCAGGCACACCAGGCTTCCCCGGAAATGCAGGCGTGCCAGGGACCCCAGGAGAACGAGGTCTAACTGGTATCAAAGGAGAAAAAGGAAATCCAGGCGTTGGAACCCAAGGTCCAAGAGGCCCCCCTGGACCAGCAGGACCTTCAGGGGAGAGTCGGCCTGGCAGCCCTGGGCCCCCTGGCTCTCCTGGACCAAGAGGCCCACCAGGTCATCTGGGGGTTCCTGGACCCCAAGGTCCTTCTGGCCAGCCTGGATATTGTGACCCCTCATCATGTTCTGCCTATGGTGTGAGAGATCTGATCCCCTACAATGATTACCAGCACTGAAGTGGAAATCCTCCACTCTGGTTCCATTGGCCCCAGACATTTAGCTGTGGATACAGAACTGTCCTGTCAACCACCACCACCACCAAGCCCCTGCCCCTAACAATGGACACTCTGCTTCCCTGCTTCTTCTGCATCCCTGCCTTCCCACTTTCAAACCTCTTGCCCACTCTGCTCCAAACATGATGGAGTGATAACATCGGAACTTAACCAAATCATATATGTCTATTTTAATAGACACTGACTGCTCCATGTCAGCCTGGATAGAGGTATATGATCGTGTGCCAAGAATTTATCCCAGACTCCCCTGTGTGACAGCTTCATAATAAAGTTACTTAACTGTGCCTCTTCCTCCTTCCTCTCCCCACACAGGATGGATGGGCATCTTTCTCCTTGACCACCCTACTCTCCCTTCCTCCCCTGATCACCTCCCCTCCCTGCTCTTCCCTGGTGATGGACTTCTAACATGAGATTTTTTAAAAAAATTTCTATTTCTTTTATAATTTTGCTGAGTTTTCAGGGTTTCTTCTGTAAATAAAACATAATATTTAAATGGTTGGTTATGATTCTAGTTTTCTAACAATTTCTGTAATGTATCTTTCCCTTCGTCTATTTACTAACTGTCTGAAACCTTATGGGGAAGGTACAAGGGGCGTGGTGGATTAAGACATCCACTGCTTTTTACCCAGCAGGATATCTCTGTGTCTCTAAGGACCCAGGTGAGGGGAGAATATCAATTTATGATTCCTGGGTGCAGCAAGTCCCCACCCCCACTTTTCCTCTTTAGCTCCCCATCCAGATCAGCCAGAGTTCACCCCTGTCCAAGATGAGCTGGAAGCCATGGAACTGTGGGGCCCTGGAGTCTGATAGCCTCAGGAGAAATTTGAAGACCAACTGCAAGAACTCTTAAGGAATCTTGTTTGAGAAAATGTTGTTATGTGGTTTGTATGCTACTTTTGGGGGGCAGGGCTCATTTCAGCAGCCTAAATCTCCTCCTTGGATAATGTTAATATTATTATTATTATTAACAAAAAATATATATTTTTAAAAAGTTCCCTTAATCTATGACATGGTAGCAATGATTTCCCTTTGGTGTCTTAATGGCATGTCAGATAATTTGTTTTTCCAGAGAAGAGAGCTCAAAGAGGAATTGGGAAAAATAAATTGAACTCTGGAATCTTCTCTCTCAAGTCCTAAAATGAACAAACAGATATGATTGTGTTTGAGGGAAATATGTCCCTAGCAGGAAAAGAATTCAAAGAGGTTCAAAGAATATGTCACTTACTCCTACTTGCTGTAGGAATAACCTTGCTGATAAGAAAAAAAGGGACAATATTGGAGAAACTACCTCTTGTTTAATTGATCTGTCCAACTCTGAGATCACTTGGTAACTGGTTTCATGTGTATCCAAAAATCAGCATTTGGATTTAAGCTTTCTGAATTTGGTAGTTTAAGAAACAGATTTAGTTTTTCAGTGGTTTTAACTCATGTGAAATAATGATTTTCCACCAGCTCTGATGCAAAGAGATATAATTTTAATGAACGATTTATCCAGCAGTGTGTTCCAGGGGTTGCCTCTCCTTATCTACGGGGATTACTTTGTACATGCAGATAAGTTTTCGCAAACCTATTTCCATTTTCTTTTGTAAGCAAATAAAACTTTAAAACAATGTATGTGGATTCTTTTTCCTGCATTTCTAAGTATCACCTTAAGCTTTTGTAGTCTTAACTGAGTGTCCACCAGAAAGACAACAGTTGTCTTCCTTTAGGTAAGCATTCAAACTTTCATTCATTCGTTTACTCACTCACTCATTCATTCATTCTGAGTGCAGTAGAAAACAGAAGAAGCAGTTAACTTGGGACTAAGAGATTAGCGACATTTTATTGTTCATTTATAATCTAGCAGGCAGCAAAGACCCTGCAAATGCATGACCTCTGCTAAATAAATGTTTATCAATAGTTGACTGAGGAGCCCACCTATCTTCTGATATTGAGGAAAGCCTAAAAACCCCTAGAAGGCAGAGCAGAAATGAGGTTGAATCTAATAGACTCTAACCCTTAAACCATACTTTGTCTTTTGCTCACAAAGGAAAAATCTAGGTATTTGAGAAAGATTTGAATTCTATTATGTGCTAGTTGAAATAGAAACAAAAGAGAACCATAAATTTAATACGTGCTCCTTCTCTGTAACATCTCCCTAGTAACAGCTAACTTTAGAAAGTAGGGATGGGATCATTTACAACTAGAAGCTGGATTCTTTCTGGATCAGGAAAAGGCTAACACGAAGGATGGTGTCTGTCTGATCACCAGGTTCTCTTTCTGTCCTTCTCATAATCTCCTGATCTTTGGAGATGAAAGATCTCCTTTCATCTTCATCTGAAGGATTCTTCAGATGATTCATCTTCAGACTTCATCTGAAGGATTCAAACAATCTACTTGTGTGCCTTTGG