Transcript asmbl_89959

Sequence
Transcript Sequence for observation asmbl_89959 of TGE0057062:
CCTCGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCTGTACCTTCTTTCTGGCAGTGAATGGTCTGTATTCCTCTAGTGATGATGTGATCGAATTAACTCCATCGAATTTCAACCGAGAAGTTATTCAGAGTGATAGTTTGTGGCTTGTAGAATTCTATGCTCCATGGTGTGGTCACTGTCAAAGATTAACACCAGAATGGAAGAAAGCAGCAACTGCATTAAAAGATGTTGTCAAAGTTGGTGCAGTTGATGCAGATAAGCATCATTCCCTAGGAGGTCAGTATGGTGTTCAGGGATTTCCTACCATTAAGATTTTTGGATCCAACAAAAACAGACCAGAAGATTACCAAGGTGGCAGAACTGGTGAAGCCATTGTAGATGCTGCGCTGAGTGCTCTGCGCCAGCTCGTGAAGGATCGCCTCGGGGGACGGAGCGGAGGATACAGTTCTGGAAAACAAGGCAGAAGTGATAGTTCAAGTAAGAAGGATGTGATTGAGCTGACAGACGACAGCTTTGATAAGAATGTTCTGGACAGTGAAGATGTTTGGATGGTTGAGTTCTATGCTCCTTGGTGTGGACACTGCAAAAACCTAGAGCCAGAGTGGGCTGCCGCAGCTTCAGAAGTAAAAGAGCAGACGAAAGGAAAAGTGAAACTGGCAGCTGTGGATGCTACAGTCAATCAGGTTCTGGCCTCCCGATACGGGATTAGAGGATTTCCTACAATCAAGATATTTCAGAAAGGCGAGTCTCCTGTGGATTATGACGGTGGGCGGACAAGATCCGACATCGTGTCCCGGGCCCTTGATTTGTTTTCTGATAACGCCCCACCTCCTGAGCTGCTTGAGATTATCAACGAGGACATTGCCAAGAGGACGTGTGAGGAGCACCAGCTCTGTGTTGTGGCTGTGCTGCCCCATATCCTTGATACTGGAGCTGCAGGCAGAAATTCTTATCTGGAAGTTCTTCTGAAGTTGGCAGACAAATACAAAAAGAAAATGTGGGGGTGGCTGTGGACAGAAGCTGGAGCCCAGTCTGAACTTGAGACCGCGTTGGGGATTGGAGGGTTTGGGTACCCCGCCATGGCCGCCATCAATGCACGCAAGATGAAATTTGCTCTGCTAAAAGGCTCCTTCAGTGAGCAAGGCATCAACGAGTTTCTCAGGGAGCTCTCTTTTGGGCGTGGCTCCACGGCACCTGTAGGAGGCGGGGCTTTCCCTACCATCGTTGAGAGAGAGCCTTGGGACGGCAGGGATGGCGAGCTTCCCGTGGAGGATGACATTGACCTCAGTGATGTGGAGCTTGATGACTTAGGGAAAGATGAGTTGTGAGAGCCACAACAGAGGCTTCAGACCATTTTCTTTTCTTGGGAGCCAGTGGATTTTTCCAGCAGTGAAGGGACATTCTCTACACTCAGATGACTCTACCAGTGGCCTTTTAACCAAGAAGTAGTACTTGATTGGTCATTTGAAAACACTGCAACAGTGAACTTTTGCATCTCAAGAAAACATTGAAAAATTCTATGAATTGTTGTAGCCGGTGAATTGAGTCGTATTCTGTCACATAATATTTTGAAGAAAACTTGGCTGTCGAAACATTTTTCTCTCTGACTGCTGCTTGAATGTTCTTGGAGGCTGTTTCTTATGTATGGGTTTTTTTTAATGTGATCCCTTCATTTGAATATTAATGGCTTTTTCCATTAAAGAATAAAATATTTTGGACAATGCCGATAAATGTATGAAGTTAGTATCCACATCATAAATTCAGAGTGATGTTTAGCAGTAAATCAATATTTTGAAGTGATACACAGATGTCTTTCCTCCCCACAAACTTTTTTAAACAAAAAACAAGACCTCTTTTCTTTAGATGGTGCCACCTATGCCCACCACAACAGAGATTTTACATGGAAACCGGGCTCAGTGAGAACTGATTTCCTGCCCAATATTTGTCTTTGGGCTGTCTCTAGTGACTAATTATTAAGGAATCTAGCTGGTTATACAGTTCAAGGCTTTCTATGTTGTTAATGAACCTCAAAATAGCCGTTAAGACATGAAATACAGCAGCAGGTTACCAATGCGAACAGGTAGTTCGCATTTATGTAAAACATTCAGAAAATGAAGTTTTGAATTTGTTGGAACATTCAAAGGACTTGAGAGCATTTTATTGTAACTTAAAAAAATAAATACAACTGTCACTAA