Transcript asmbl_89478

Sequence
Transcript Sequence for observation asmbl_89478 of TGE0058238:
GGAATCTGCGCGAGCTCGGCGGGAATCTGCGCAAGCTCGGCGGGAATCTGCGCATGCTCAGAGTTCCGGGGCACGGTTTCCCCGCCCCTTTCAGGCCTAGCAGGAAACGAAGCGGCTCTTTCCGCTATCTGCCGCTTGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGGCTTTACCATGAGTAACTCCATTCCTGGTATAGAATCCCCATTTGAACAAGCAAAGAAGGTGATAACCATGTTTGTACAGCGACAGGTGTTTGCTGAGAACAAGGATGAGATTGCTTTAGTCCTGTTTGGTACAGATGGCACTGACAATCCCCTTTCTGGTGGGGATCAGTATCAGAACATCACAGTGCACAGACATCTGATGCTACCAGATTTTGATTTGCTGGAGGACATTGAAAGCAAAATCCAACCAGGTTCTCAACAGGCTGACTTCCTGGATGCACTAATCGTGAGCATGGATGTGATTCAACATGAAACAATAGGAAAGAAGTTTGAGAAGAGGCATATTGAAATATTCACTGACCTCAGCAGCCGATTCAGCAAAAGTCAGCTGGATATTATAATTCATAGCTTGAAGAAATGTGACATCTCCCTGCAATTCTTCTTGCCTTTCTCACTTGGCAAGGAAGATGGAAGTGGGGACAGAGGAGATGGCCCCTTTCGCTTAGGTGGCCATGGGCCTTCCTTTCCACTAAAAGGAATTACCGAACAGCAAAAAGAAGGTCTTGAGATAGTGAAAATGGTGATGATATCTTTAGAAGGTGAAGATGGGTTGGATGAAATTTATTCATTCAGTGAGAGTCTGAGAAAACTGTGCGTCTTCAAGAAAATTGAGAGGCATTCCATTCACTGGCCCTGCCGACTGACCATTGGCTCCAATTTGTCTATAAGGATTGCAGCCTATAAATCGATTCTACAGGAGAGAGTTAAAAAGACTTGGACAGTTGTGGATGCAAAAACCCTAAAAAAAGAAGATATACAAAAAGAAACAGTTTATTGCTTAAATGATGATGATGAAACTGAAGTTTTAAAAGAGGATATTATTCAAGGGTTCCGCTATGGAAGTGATATAGTTCCTTTCTCTAAAGTGGATGAGGAACAAATGAAATATAAATCGGAGGGGAAGTGCTTCTCTGTTTTGGGATTTTGTAAATCTTCTCAGGTTCAGAGAAGATTCTTCATGGGAAATCAAGTTCTAAAGGTCTTTGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAGAAAGATGAGAAGACAGACACCCTTGAAGACTTGTTTCCAACCACCAAAATCCCAAATCCTCGATTTCAGAGATTATTTCAGTGTCTGCTGCACAGAGCTTTACATCCCCGGGAGCCTCTACCCCCAATTCAGCAGCATATTTGGAATATGCTGAATCCTCCCGCTGAGGTGACAACAAAAAGTCAGATTCCTCTCTCTAAAATAAAGACCCTTTTTCCTCTGATTGAAGCCAAGAAAAAGGATCAAGTGACTGCTCAGGAAATTTTCCAAGACAACCATGAAGATGGACCTACAGCTAAAAAATTAAAGACTGAGCAAGGGGGAGCCCACTTCAGCGTCTCCAGTCTGGCTGAAGGCAGTGTCACCTCTGTTGGAAGTGTGAATCCTGCTGAAAACTTCCGTGTTCTAGTGAAACAGAAGAAGGCCAGCTTTGAGGAAGCGAGTAACCAGCTCATAAATCACATCGAACAGTTTTTGGATACTAATGAAACACCGTATTTTATGAAGAGCATAGACTGCATCCGAGCCTTCCGGGAAGAAGCCATTAAGTTTTCAGAAGAGCAGCGCTTTAACAACTTCCTGAAAGCCCTTCAAGAGAAAGTGGAAATTAAACAATTAAATCATTTCTGGGAAATTGTTGTCCAGGATGGAATTACTCTGATCACCAAAGAGGAAGCCTCTGGAAGTTCTGTCACAGCTGAGGAAGCCAAAAAGTTTCTGGCCCCCAAAGACAAACCAAGTGGAGACACAGCAGCTGTATTTGAAGAAGGTGGTGATGTGGACGATTTATTGGACATGATATAGGTCGTGGATGTATGGGGAATCTAAGAGAGCTGCCATCGCTGTGATGCTGGGAGTTCTAACAAAACAAGTTGGATGCGGCCATTCAAGGGGAGCCAAAATCTCAAGAAATTCCCAGCAGGTTACCTGGAGGCGGATCATCTAATTCTCTGTGGAATGAATACACACATATATATTACAAGGGATAATTTAGACCCCATACAAGTTTATAAAGAGTCATTGTTATTTTCTGGTTGGTGTATTATTTTTTCTGTGGTCTTACTGATCTTTGTATATTACATACATGCTTTGAAGTTTCTGGAAAGTAGATCTTTTCTTGACCTAGTATATCAGTGACAGTTGCAGCCCTTGTGATGTGATTAGTGTCTCATGTGGAACCATGGCATGGTTATTGATGAGTTTCTTAACCCTTTCCAGAGTCCTCCTTTGCCTGATCCTCCAACAGCTGTCACAACTTGTGTTGAGCAAGCAGTAGCATTTGCTTCCTCCCAACAAGCAGCTGGGTTAGGAAAACCATGGGTAAGGACGGACTCACTTCTCTTTTTAGTTGAGGCCTTCTAGTTACCACATTACTCTGCCTCTGTATATAGGTGGTTTTCTTTAAGTGGGGTGGGAAGGGGAGCACAATTTCCCTTCATACTCCTTTTAAGCAGTGAGTTATGGTGGTGGTCTCATGAAGAAAAGACCTTTTGGCCCAATCTCTGCCATATCAGTGAACCTTTAGAAACTCAAAAACTGAGAAATTTACTACAGTAGTTAGAATTATATCACTTCACTGTTCTCTACTTGCAAGCCTCAAAGAGAGAAAGTTTCGTTATATTAAAACACTTAGGTAACTTTTCGGTCTTTCCCATTTCTACCTAAGTCAGCTTTCATCTTTGTGGATGGTGTCTCCTTTACTAAATAAGAAAATAACAAAGCCCTTATTCTCTTTTTTTCTTGTCCTCATTCTTGCCTTGAGTTCCAGTTCCTCTTTGGTGTACAGACTTCTTGGTACCCAGTCACCTCTGTCTTCAGCACCCTCATAAGTCGTCACTAATACACAGTTTTGTACATGTAACATTAAAGGCATAAATGACTCATCTCTCTGTGAATTGCTGCTAATTATTGTCTGCAAAAGACTTCTTCAGTGCTCTGCTGAGAATTGAACACCCTTATCCATTGATTGAAAATGGATCTGCAAGATAGAACATCATTCATTTAGCTGAGGAGAGAAAGGAGTGCTTTACTTTGGGCTTCTAGGACATCCTCTCAATACTATACACACTTGCATCAAACTTGACATACAGGTGCTCATTTAAAGTAACCCCAACAGAGGATGACATATAGTTTCTGGTTAGATAGTTAAAGCCCAGGGGTTGTTTGTGACTTGGACAAAACTGAGACATTCTTAGAACCACAGAGAGTGGAAACTTTGATCTCTGAAATCTTCATTATTCTCATCAGATCCTCCCAGCAATATGAATCAGCTCAGTAAGTATGGCTCCATCAGCAGCCCCTGTCTTTGGCAGTTTGGGGAATTTCTTTTGGGAAACGTCAGTCTTTTTGTCATGCCAGGAAAAGTTTAAATCAAGTTAGTCCTTTAGATCTTCTGATACTTTTTGACTTAGTTTGAATGCAGCAGGATTATTTGTGCTTCTCTAACCCTGTTTTACCTAAATCTCAATACCTCAAGGAAGAAATTAGTTTCACAGGCTAAGGAGAGGAAGAACTAAATGAGTCATGTAATTTCCAAATCCATTTCATACAGGTGAAGTATATGTGCTATGTAGACTTCATCAGAGCGTACTGTTTTGAGTAGGGACAGCGTGTTTTGCATGAACACATCACAGTCCCATTTCCGTGAAATGAGATTGGCAGATCTACAGAACTCCCAGGTGTTCTGCTGAGTGTAGCCCTGGAGGACAGCAAGTGCTGTATTGTCGTCAATCCACCATGGGCTGCTTCTCAGAAGCCCAGTAATCCCACAAATGATAGGCTTGTCTGTGATTGCAAGTCACTGACTATGGACCCGGTCACCTTTTTCTTCTAT