Transcript asmbl_22685

Sequence
Transcript Sequence for observation asmbl_22685 of TGE0008541:
GAGTGTACGCGTTGCCGGCGAAGAGGGGAGCCTGACGACTCGGAAATTTGAATACCACAGTAGCATGGAGTGTGACCTCGTGGAGACTGACATCTTGGAGTCGTTGGAAGATCTAGGTTACAAGGGTCCATTGTTAGAAGATGGCGCTCTGTCTCAGGCAGTCTCTGCTGGAGCCAGTTCCCCTGAGTTTACCAAACTCTGTGCTTGGCTGGTGTCTGAATTAAGAGTGCTCTGTAAACTGGAGGAAAATGTGCAAGCAACTAACAGCCCAGGTGAAGCTGAAGAATTCCAGCTTGAGGTGAGTGGGCTACTAGGGGAGATGAACTGTCCCTATCTTTCACTGACATCTGGGGATGTGACCAAGCGCCTTCTCGTTCAGAAGAACTGCCTCCTTTTGCTCACATACCTCATCTCAGAACTAGAAGCTGCCAGAATGCTCTGTGTGAATACTCCTCCAAAAAAAGCTCAAGAAGGAGGCGGTAGTGAGGTCTTTCAAGAGTTGAAAGGCATATGTATTGCTCTAGGAATGTCCAAACCTCCAGCCAATATAACTATGTTCCAATTCTTCAGCGGGATTGAAAAAAAATTAAAGGAAACATTAGCAAAAGTTCCACCTAATCATGTGGGAAAGCCTTTATTGAAGAAGTCAATGGGACCAGCCCACTGGGAAAAAATAGAAGCAATTAACCAAGCCATAGCCAATGAATATGAAGTTCGGAGAAAGCTGCTAATAAAACGTTTGGACGTCACTGTCCAATCTTTTGGTTGGTCTGACAGAGCTAAGAGTCAGACAGAGAAATTAGCAAAGGTTTACCAGCCAAAACGTTCACTCTTATCTCCTAAAAGTACTATTTCTGTTGCCCACCTTTTGGCTGCAAGACAAGACTTGTCAAAGATTTTAAGGACAAGCAGTGGCTCTGTAAGAGAAAAGACCGCCTGTTCCATCAATAAGGTGCTGATGGGCAGGGTACCTGACAGAGGAGGTAGACCCAACGAAATTGAACCACCGCCCCCAGAGATGCCACCATGGCAGAAAAGGCAAGATGGACCCCAGCAGCAAACAGGAGGCCGAGGAGGAGGGCGAGGTGGTTATGAACAGTCCTCATATGGAGGACGAGGAGGTCATGAACAAGGAGGAGGGAGAGGTGGACGTGGTGGCTACGACCATGGTGGCCGAGGGGGAGGAAGAGGAAATAAGCATCAAGGAGGCTGGACAGATGGAGGGAGTGGAGGAGGAGGTGGCTACCAAGATGGTGGTTATCGAGATTCGGGCTTCCAGCCTGGTGGCTATCATGGTGGCCACAGTGGTGGCTACCAAGGTGGTGGTTATGGTGGCTACCAAACATCTACATATACAGGAAGTGGATACCAGGGTAGTGGCTACCAGCAGGACAATAGATACCAAGATGGCGGGCACCATGGTGATCGAGGCAGTGGTCGCGGAGGGCGGGGTGGCCGTGG