Transcript asmbl_79825

Sequence
Transcript Sequence for observation asmbl_79825 of TGE0058232:
TACTGCACCCTGGGCCCCAGCGGACCATGGCATTAACTGCTCTCTCTCTCTCTCTCCTTCTCTCTTTCTCCCCTCGCCATCCCACCCCTGCCATCCTGTGTGCCATCTCATGGCTCTCTTGCCTCCCTGCCCACATCTCCCTGGACCCCTTCCCTTTTACCTGGTCTCTTGGGGCCGCTGTCTCCCTGCTCCCCGCCACTGTCCTGTCTGCCTGCTGTGCACATGGGGCGGCCCCTCTTGCCTACTCTGGGCCCGGCCTCCTCTGCTATGCCTGCGTCCTCGGAGCAGAAGCAGACAGGCAGCATGGACTCCGATGACTTCAGGGCTCTGCTTATCTCCACAGGATACAGCCTGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGG