Transcript asmbl_79824

Sequence
Transcript Sequence for observation asmbl_79824 of TGE0058231:
TGAGCAGCCTGCCACCTCCTCGGCCTCTCCCCTCCCGCCGTTGCCGTACCAGCCCACACCTTCGTCTCTGCATCTGTTCGTCCATTCCCATCACAGTTGCTGAGCGTCGGCCGCCACTCCCAGGGCCAGCAGGGCCCTGCCACTGTCAGGGTGTAGGTGTGCGGCACCAAGACCCCAGCCTGGGCCACTTCACACGCACAGGCAGGGGGCCGGAGGTCCCAAGTCCTGCCTTCTGGGGTGGCATCCTCACCACCCCCAGGGCAGATGAAGTCTCAGCACACCCAGGCTTTGCGACCCGGTCTGTGAACCTGGACACAGACACCCCGCACAGTGCTTTTAGAATTCAGATTTGGTCCGGCAGCCTCATCAGAGGGGCCCTGAGCGCCAGAGTTTGCTGCCATCCCCAGCCCACCCCTGCCGGGCTGACGGACTGAGAAGTGTGCAGCCTCAGCTCTGCACCTGGCGCCCCCAGGACAGGATACAGTCCCCTCTGTCCCACTCCAAATCCCAAAGGCAAGGAGAACCCCCCCCCCGACCCTCCACCAGTCCTGGGACTTGTCCTCAGTTCTGTAGCATCCAGCTGCCACCCCTGCTGTGGGCAGAGAGGTCGGGGAGGCCTCTGCCTTCCTTTGAGCTTCCGAGGTTGGGGAAAGGATGAAAGGGGCCCGTGCCGCCCCCGACCCCACGTGTCCCTGGCCATCTCCTTGTCCATGTTGCCTCTAACTCTGTGTTTCCCTCCCCTACGTGTCCCTTCCCCCTGCCCTCTGCATGTGACCCCGATCCCTCATCCTGGTCTCCACGCCGCCCCTCCCGCACACCTGCCTTCGGATGGCCCCGGCAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGG