Transcript asmbl_79126

Sequence
Transcript Sequence for observation asmbl_79126 of TGE0058226:
CGCGGAGAAAATGGCGGCAGGGGTCGAAGCGGCGGCGGAGGTGGCGGCGACGGAGATCAAAATGGAGGAAGAGAGCGGCGCGCCCGGCGTGCCGAGCGGCAACGGGGCTCCGGGCCCTAAGGGTGAAGGAGAACGACCTGCTCAGAATGAGAAGAGGAAGGAGAAAAACATAAAAAGAGGAGGCAATCGCTTTGAGCCATATGCCAATCCAACTAAAAGATACAGAGCCTTCATTACAAACATACCTTTTGATGTGAAATGGCAGTCACTTAAAGACCTGGTTAAAGAAAAAGTTGGTGAGGTAACATACGTGGAGCTCTTAATGGACGCTGAAGGAAAGTCAAGGGGATGTGCTGTTGTTGAATTCAAGATGGAAGAGAGCATGAAAAAAGCTGCGGAAGTCCTAAACAAGCATAGTCTGAGCGGAAGACCACTGAAAGTCAAAGAAGATCCTGATGGTGAACATGCCAGGAGAGCAATGCAAAAGGTGATGGCTACGACTGGTGGGATGGGTATGGGACCAGGTGGCCCAGGAATGATTACTATCCCACCCAGTATCCTAAATAATCCCAACATCCCAAATGAGATTATCCATGCATTACAGGCTGGAAGACTTGGAAGCACAGTATTTGTAGCAAATCTGGATTATAAAGTTGGCTGGAAGAAACTGAAGGAAGTATTTAGTATGGCTGGTGTGGTGGTCCGAGCAGACATTCTTGAAGATAAAGATGGAAAAAGTCGTGGAATAGGCACTGTTACTTTTGAACAGTCCATTGAAGCTGTGCAAGCTATATCTATGTTCAATGGCCAGCTGCTATTTGATAGACCAATGCACGTCAAGATGGATGAGAGGGCCTTACCAAAAGGAGATTTCTTCCCTCCTGAGCGTCCACAACAACTTCCCCATGGCCTTGGTGGTATTGGCATGGGGTTAGGACCAGGAGGGCAACCCATTGATGCCAATCACCTGAATAAAGGCATCGGAATGGGAAACATAGGTCCCGCAGGAATGGGAATGGAAGGCATAGGATTTGGAATAAATAAAATGGGAGGAATGGAGGGGCCCTTTGGTGGTGGTATGGAAAACATGGGTCGATTTGGATCTGGGATGAACATGGGCAGGATAAATGAAATCCTAAGTAATGCACTGAAGAGAGGAGAGATCATTGCAAAGCAGGGAGGAGGTGGAGGTGGAGGAAGCGTCCCTGGGATCGAGAGGATGGGTCCTGGCATTGACCGCCTCGGGGGTGCCGGCATGGAGCGCATGGGCGCGGGCCTGGGCCACGGCATGGATCGCGTGGGCTCCGAGATCGAGCGCATGGGCCTGGTCATGGACCGCATGGGCTCCGTGGAGCGCATGGGCTCCGGCATTGAGCGCATGGGCCCGCTGGGCCTCGACCACATGGCCTCCAGCATTGAGCGCATGGGCCAGACCATGGAGCGCATTGGCTCTGGCGTGGAGCGCATGGGTGCCGGCATGGGCTTCGGCCTTGAGCGCATGGCCGCTCCCATCGACCGTGTGGGCCAGACCATTGAGCGCATGGGCTCTGGCGTGGAGCGCATGGGCCCTGCCATCGAGCGCATGGGCCTGAGCATGGAGCGCATGGTGCCCGCAGGTATGGGAGCTGGCCTGGAGCGCATGGGCCCCGTGATGGATCGCATGGCCACCGGCCTGGAGCGCATGGGCGCCAACAAGCCTCGAGCGCATGGGCCCTGCCATGGGCCCGGCCCTGGGCGCTGGCATTGAGCGCATGGGCCTGGCCATGGGTGGCGGTGGCGGTGCCAGCTTTGACCGTGCCATCGAGATGGAGCGTGGCAACTTCGGAGGAAGCTTCGCAGGTTCCTTTGGTGGAGCTGGAGGCCATGCTCCTGGGGTGGCCAGGAAGGCCTGCCAGATATTTGTGAGAAATCTGCCATTCGATTTCACATGGAAGATGCTAAAGGACAAATTCAACGAGTGCGGCCACGTGCTGTACGCCGACATCAAGATGGAGAATGGGAAGTCCAAGGGGTGTGGCGTGGTTAAGTTCGAGTCGCCAGAGGTGGCCGAGAGAGCCTGCCGGATGATGAATGGCATGAAGCTGAGTGGCCGAGAGATTGACGTTCGAATTGATAGAAACGCTTAAGCAGTTGCCTTTTTTAAACATCGATACGAGACCTCTGAATTTGTATTTTTTCTTGTTAACCATTTTAATTTGTTGGCTGGATGTATAAAGATGTTTAAAAAATTCAGTTGCTTTTTGGGGTAATTTGAATTACTTTTTTAATGACTGGGGTTCCATTTGACTGTTTGCATTGAGATTGCAATGTGCGCAATTTTTTTTGTAGTTGTGGCATCTTGTTGACATCGAATATGACTTTGATAATAAATACCGGTTCCTGAAAA