Transcript asmbl_78390

Sequence
Transcript Sequence for observation asmbl_78390 of TGE0058224:
GGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAAGGACCGAAAGGTTCGGCGCAAGGAGCCCAAGAGCCAGGATATCTACCTGAGGCTGTTGGTCAAGTTATACAGGTTTCTGGCCAGAAGAACCAACTCCACATTCAACCAGGTTGTGTTGAAGAGGTTGTTTATGAGTCGCACCAACCGGCCGCCTCTGTCCCTTTCCCGGATGATCCGGAAGATGAAGCTTCCTGGCCGGGAAAACAAGACGGCCGTGGTTGTGGGGACCATAACTGATGATGTGCGGGTTCAGGAGGTACCCAAACTGAAGGTATGTGCACTGCGCGTGACCAGCCGGGCCCGCAGCCGCATCCTCAGGGCAGGGGGCAAGATCCTCACTTTCGACCAGCTGGCCCTGGACTCCCCTAAGGGCTGTGGCACTGTCCTGCTCTCCGGTCCTCGCAAGGGCCGAGAGGTGTACCGGCATTTCGGCAAGGCCCCAGGAACCCCGCACAGCCACACCAAACCCTACGTCCGCTCCAAGGGCCGGAAGTTCGAGCGTGCCAGAGGCCGACGGGCCAGCCGAGGCTACAAAAACTAACCCTGGATCCTACTCTCTTATTAAAAAGATTTTTGCTGACA