Transcript asmbl_76275

Sequence
Transcript Sequence for observation asmbl_76275 of TGE0000954:
GTCAGACCCACTCTGCGGGCCAAGAAAGGTGACCGGGCTTCCTTCCGGCTTGCTAAGCAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCAACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAATAACTTCAAATTCCAGCCAAACGTTCCTTGTTGCCACTTTGGGTATTCTGAGATTTTCTCTTGCATGCCCTTAGCTTTACAGCTTTTGCATTTCCTGTTGTATTTATTCTCAGCCATTTTGGGCATATGTATCTTTATAATCAGACTGGAAACGGGACTTTCTATTAATATCATTTTCAGAATAAAAAATAGGATAATTTAACCTACCAGCCCTTCTCCCCCAATAACTGTGGTCTATACAGAGTCAATATATTTTTTCAGAGAAAGTTATTCGCTCGATTTTTTCTGAATCATAATTAAACTTTATGATAAAA