Transcript asmbl_70348

Sequence
Transcript Sequence for observation asmbl_70348 of TGE0057302:
CCCCTGGCCAGTGCCTGGGGATGCCAGCAGAAGTCCTGGCAAGTCACAGGAAGATGCTGGCTGGGAAGTCAGGGCCTGCTGAGCGCTAAACCAGAACCCGAGCCTGGCAGGCTCTCAAAGACGGGATGCTTGTCGTCGAGTCTCATACGCTAACCTCTGCTCCGCCTCTTCTCAGAGCTGCGCATAAAATCCAGCTTTGTGGCACCTCTGGAAAAGTCATATGGGACCAGGCCCAGAGTCCTGACGGGCAACCCTCGCTTGGACCTGCAAGAGATCAACAACTGGGTGCAGGCGCAGATGAAAGGGAAGCTCGCCAGGTCCACAAAGGAAATTCCCGATGAGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCAAGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTCGAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGGGTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAGTGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCACCTCCGAGTTCATTCATGACATAGACCGAGAACTGAAGACCGTGCAGGCGGTCCTCACTGTCCCCAAGCTGAAGCTGAGTTATGAAGGCGAAGTCACCAAGTCCCTGCAGGAGATGAAGCTGCAATCCTTGTTTGATTCACCAGACTTTAGCAAGATCACAGGCAAACCCATCAAGCTGACTCAGGTGGAACACCGGGCTGGCTTTGAGTGGAACGAGGATGGGGCGGGAACCACCCCCAGCCCAGGGCTGCAGCCTGCCCACCTCACCTTCCCGCTGGACTATCACCTTAACCAGCCTTTCATCTTCGTACTGAGGGACACAGACACAGGGGCCCTTCTCTTCATTGGCAAGATTCTGGACCCCAGGGGCCCCTAATATCCCAGTTTAATATTCCAATACCCTAGAAGAAAACCCGAGGGACAGCAGATTCCACAGGACACGAAGGCTGCCCCTGTAAGGTTTCAATGCATACAATAAAAGAGCTTTATCCCTAA