Transcript asmbl_50180

Sequence
Transcript Sequence for observation asmbl_50180 of TGE0000365:
CCACGTGGGGGCTCAGCGTGCACCCTTCTTTGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTCGCTGGCAGTCTGAACGGCAAGCTTGAGTCAGGACCCTTAATTAAGATCCTCAATTGGCTGGAGGGCAGATCTCGCGAGTAGGGCAACGCGGTAAAAATATTGCTTCGGTGGGTGACGCGGTACAGCTGCCCAAGGGCGTTCGTAACGGGAATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTCAGGACAGAGCCAGAGGCCAAGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCAGCAGGAGAGGGCCCAGCCCTGTATGAGGACCCCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTCAATGTGGCACATGAAGAAATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCTGGCTTCACGCCACAAGAGCGCCAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTTAGGCACCTCTACCCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAGAATGTTGGTTGGCGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGACAGCAAGATCCGTTCCAAGGCCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCACTGTGACACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTACCATTCCTTCTTTAAACACTCTTCAGAGAAATCTGCATTCTATTTCTCATGTATAAAACTAGGAATCCTCCAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTTTTTATTTGAGGGTTTTTTGTTTTTTAAAAAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCACATGAAAATAAAGAGCCATAGTTTCA