Transcript asmbl_50179

Sequence
Transcript Sequence for observation asmbl_50179 of TGE0000365:
CCACGTGGGGGCTCAGCGTGCACCCTTCTTTGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTCGCTGGCAGTCTGAACGGCAAGCTTGAGCAACGCGGTAAAAATATTGCTTCGGTGGGTGACGCGGTACAGCTGCCCAAGGGCGTTCGTAACGGGAATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTCAGGACAGAGCCAGAGGCCAAGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCAGCAGGAGAGGGCCCAGCCCTGTATGAGGACCCCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTCAATGTGGCACATGAAGAAATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCTGGCTTCACGCCACAAGAGCGCCAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTTAGGCACCTCTACCCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAGAATGTTGGTTGGCGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGACAGCAAGATCCGTTCCAAGGCCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCACTGTGACACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTACCATTCCTTCTTTAAACACTCTTCAGAGAAATCTGCATTCTATTTCTCATGTATAAAACTAGGAATCCTCCAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTTTTTATTTGAGGGTTTTTTGTTTTTTAAAAAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCACATGAAAATAAAGAGCCATAGTTTCA