Transcript asmbl_41574

Sequence
Transcript Sequence for observation asmbl_41574 of TGE0058164:
TGGGAATCCAGGAAAGGAGGGAATGGGGTGGGGCTAGATGAAAAGGGATAGGTGTCCAGGGAGAGCCTCTGGCTATTCCTGGGACCAGGAAGTTTTCACTAGGATACATAACACTTTTTACACACTCACCCCACCCATCCCTGGCTTTCTATTCATGGAACAACCTCTCTCTACAATCCCTCCAGATCTTCGCAAATACTGTGGACAATGCCCGCATCGTTCTGCAGATTGACAATGCCCGTCTTGCTGCTGATGACTTTAGAGTCAAGTATGAGACAGAGCTGGCCATGCGCCAGTCTGTGGAGAACGACATCCATGGGCTCCGCAAGGTCATTGATGACACCAATATCACACGACTGCAGCTGGAGACAGAGATCGAGGCTCTCAAGGAGGAGCTGCTCTTCATGAAGAAGAACCACGAAGAGGAAGTAAAAGGCCTACAAGCCCAGATTGCCAGCTCTGGGTTGACCGTGGAGGTAGATGCCCCCAAATCTCAGGACCTCGCCAAGATCATGGCAGACATCCGGGCCCAATATGACGAGCTGGCTCGGAAGAACCGAGAGGAGCTAGACAAGTACTGGTCTCAGCAGATTGAGGAGAGCACCACAGTGGTCACCACACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGAGACCAATGACACCAAAGTTCTGAGGCATTAAGCCAGCAGAAGCAGGGTACCCTTTGGGGAGCAGGAGGCCAATAAAAAGTTCAGAGTTCATTGGATGTC